【病毒外文文献】2007 Importance of the Penultimate Positive Charge in Mouse Hepatitis Coronavirus A59 Membrane Protein

JOURNAL OF VIROLOGY May 2007 p 5339 5348 Vol 81 No 10 0022 538X 07 08 00H110010 doi 10 1128 JVI 02427 06 Copyright 2007 American Society for Microbiology All Rights Reserved Importance of the Penultimate Positive Charge in Mouse Hepatitis Coronavirus A59 Membrane Protein H17188 Sandhya Verma 2 Lisa A Lopez 1 2 3 Valerie Bednar 2 and Brenda G Hogue 1 2 School of Life Sciences 1 The Biodesign Institute Center for Infectious Diseases and Vaccinology 2 and Molecular and Cellular Biology Graduate Program 3 Arizona State University Tempe Arizona 85287 5401 Received 4 November 2006 Accepted 15 February 2007 The coronavirus membrane M protein carboxy tail interacts with the nucleocapsid during virus assembly Previous studies demonstrated that the two terminal residues are important and the charged residue R227 in the penultimate position in the mouse hepatitis coronavirus MHV A59 M protein was suggested to participate in intermolecular interactions with negative charges in the nucleocapsid N protein To determine the significance of the positive charge at position 227 we substituted the arginine with lysine K aspartic acid D glutamic acid E or alanine A and studied these by reverse genetics in the context of a MHV full length infectious clone Viruses with wild type phenotype were readily recovered with the K or A substitutions In contrast negative charge substitutions were not tolerated as well In all recovered R227D viruses the negative charge was replaced with heterologous residues resulting from apparent template switching during negative strand synthesis of subgenomic RNA 7 An additional second site compensatory V202I substitution was present in some viruses Recovered R227E viruses had second site changes within the M protein carboxy tail that were partially compensatory Significantly most of the second site changes in the R227E mutant viruses were previously shown to compensate for the removal of negative charges in the N protein Our results strongly indicate that a positive charge is not absolutely required It is clear that other regions within the tail must also be involved in helping mediate interactions between the M protein and the nucleocapsid Coronaviruses are enveloped positive stranded RNA viruses that belong to the Coronaviridae family in the Nidovirales or der The viruses are medically important viruses that cause primarily respiratory and enteric infections in humans and a wide range of animals Recently new human coronaviruses including the severe acute respiratory syndrome SARS coro navirus SARS CoV HCoV NL63 and HCoV HKU1 were identified which significantly increased the interest in under standing this family of viruses and development of therapeutic treatments against them 9 16 Understanding key interac tions during virus assembly can provide insight to potential targets for antiviral and vaccine development The coronavirus virion envelope contains at least three in tegral membrane proteins The spike S membrane M and envelope E proteins are anchored in the virion envelope The S glycoprotein is the receptor binding protein that facilitates infection through fusion of viral and cellular membranes and is the major target of neutralizing antibodies 14 The M glyco protein is a major component of the envelope that plays an important role in virus assembly 8 17 24 26 31 The E protein is a minor component of the viral envelope that plays an important but not yet fully defined role s during the virus life cycle 1 4 31 The nucleocapsid N protein encapsidates the viral genome as a helical nucleocapsid inside the virion 5 20 Assembly of these components into virions occurs at in tracellular membranes in the region of the endoplasmic retic ulum Golgi intermediate compartment ERGIC 18 30 The focus of this report is the M protein It is the most abundant protein in the viral envelope It plays a key role in virus assembly through interactions with itself the other enve lope proteins and the nucleocapsid 7 8 11 19 24 26 The overall structure of the M protein is conserved across the family The type III protein consists of three hydrophobic transmembrane domains a short amino terminus exposed on the outside of the virion and a long carboxy tail that consist of an amphiphilic region followed by a hydrophilic domain Fig 1 27 The protein localizes in the Golgi when expressed alone 17 18 Coexpression of the M and E proteins in the absence of the other viral components is sufficient for assembly of virus like particles VLPs 1 4 31 In the present study we examined the importance of the pen ultimate charged residue in the mouse hepatitis coronavirus MHV A59 M protein tail Fig 1 Previous studies demon strated that the extreme carboxy residues are very important in virus assembly 6 19 The presence of a conserved charged residue positioned close to the end of the hydrophilic domain prompted us to ask whether the specific charge is important Fig 1 The positively charged arginine R in MHV A59 M at posi tion 227 was changed to lysine K alanine A aspartic acid D or glutamic acid E and studied by reverse genetics using a full length MHV infectious genome The results show that the presence of a positive charge is not absolutely required at this position Replacement of the amino acid with either positively charged lysine or neutrally charged alanine was not disruptive since stable viruses were readily isolated that are phenotypically like the wild type WT virus However placement of a negatively charged residue at this position is clearly not preferred Corresponding author Mailing address Biodesign Institute P O Box 875401 Arizona State University Tempe AZ 85287 5401 Phone 480 965 9478 Fax 480 727 7615 E mail Brenda Hogue asu edu S V and L A L contributed equally to this study H17188 Published ahead of print on 28 February 2007 5339 on May 24 2015 by UNIVERSITATSBIBLIOTHEK GIESSEN http jvi asm org Downloaded from MATERIALS AND METHODS Cells and viruses WT MHV A59 and infectious cloned viruses were grown in mouse 17 clone 1 17Cl1 or L2 cells Virus titers were determined in L2 cells Cells were maintained in Dulbecco modified Eagle medium supplemented with 5 to 10 heat inactivated fetal calf serum Baby hamster kidney cells expressing the MHV Bgp 1a receptor 34 were maintained in Glasgow modified Eagle medium supplemented with 5 heat inactivated fetal calf serum 10 tryptose phosphate broth and Geneticin G418 Construction of charge substitution mutants Site directed mutations were introduced into plasmid pGEM 5Zf H11002 M N a pGEM5Zf H11002 vector Promega containing the entire M and N genes EcoRV SacI fragment A protocol based on the gene editor site directed mutagenesis system from Promega was used with the primers shown in Table 1 All mutations were confirmed by sequencing the region between the NheI and BssHII unique restriction sites within the M and N genes respectively prior to being shuttled into MHV G clone in place of the WT fragment 34 Generation of mutant viruses Mutant viruses were generated by using an MHV A59 infectious clone 34 Full length cDNA clones were assembled ba sically as previously described 32 Plasmids containing the cDNA cassettes spanning the MHV genome were digested with the appropriate restriction en zymes gel purified and ligated overnight to assemble the full length genomic cDNA clone Ligated cDNAs were extracted with phenol chloroform and etha nol precipitated RNA transcripts were made by using the mMessage mMachine T7 transcription Ambion reagents supplemented with additional GTP The MHV nucleocapsid gene was transcribed from pMHV A59 N 3 by using T7 RNA polymerase and polyadenylated using Ambion s poly A tailing system Full length MHV infectious cloned genomic RNA and N transcripts were electroporated into BHK MHVR cells 10 7 cells ml in OptiMEM Invitrogen RNA transcripts were electroporated in a 4 mm gap cuvette with three electrical pulses of 850 V at 25 H9262F by using a Bio Rad Gene Pulser II electroporator Transfected cells were monitored for fusion 12 to 48 h after electroporation An aliquot of the frozen stock from the electroporated cells was used to infect L2 cells The media were harvested from the infected cells at approximately 24 h postinfection p i Total RNA was extracted from cells remaining adhered to the flasks using Ambion s RNAqueous 4PCR extraction buffers Reverse tran scription PCR RT PCR products from the RNA were sequenced directly to confirm the presence of the mutations in the M gene Ten to twenty plaques were subsequently isolated from the electroporated cell medium virus stock Plaque purified viruses were passaged onto L2 cells RNA was extracted from the infected cells at approximately 24 h p i RT PCR was performed and the en tireties of the E M and N genes were sequenced Selected plaque purified viruses were amplified on L2 or Prc 1 cells through five passages at which time the sequences of the E M and N genes and in some cases the 3H11032 end of the S gene and the packaging signal region in gene 1b were again confirmed Growth kinetics Growth kinetic experiments were carried out in 17Cl1 cells infected with P5 virus stocks Cell culture supernatants were collected at various times p i Titers were determined by plaque assay on L2 cells At approximately 48 to 72 h p i the agarose medium overlays were removed before cells were stained with crystal violet Analysis of VLPs BHK 21 cells were seeded 1 day prior to achieving 70 to 80 confluence for infection at a multiplicity of infection MOI of 5 with vaccinia virus vTF7 3 that expresses T7 RNA polymerase 13 Cells were trans fected with pcDNA3 1 plasmids containing either WT or mutated M genes singly and in combination with the WT E gene immediately after infection using Lipofectamine Invitrogen Life Technologies Cells were incubated in OptiMEM medium at 37 C for 12 h at which time the medium and intracellular cytoplasmic lysates were harvested Cells were lysed on ice in a buffer containing 100 mM Tris 100 mM NaCl 0 5 Triton X 100 and 1 mM phenylmethylsulfonyl fluo ride The media were clarified at 14 000 H11003 g for 15 min at 4 C VLPs were collected by pelleting the clarified medium through a 30 sucrose cushion by ultracentrifugation for3hat4 CinaBeckman SW55Ti rotor at 30 000 rpm Pellets were resuspended directly in Laemmli sodium dodecyl sulfate polyacryl amide gel electrophoresis SDS PAGE sample loading buffer Intracellular and extracellular samples were analyzed by SDS PAGE Proteins were transferred to polyvinylidene difluoride membranes and analyzed with anti MHV M A03 kindly provided by Kathryn Holmes University of Colorado Health Sciences and an anti MHV E antibody L A Lopez and B G Hogue unpublished data After incubation with appropriate secondary antibodies the blots were visualized by chemiluminescence Pierce Protein products were quantified by densitomet ric scanning of the fluorograms and analyzed by using ImageQuant software Molecular Dynamics Indirect immunofluorescence BHK cells were transfected with pCAGGS 25 plasmids containing the WT or mutant M genes to determine the localization of the proteins Cells were plated on two well glass slides 1 day before transfection with Lipofectamine At 16 h after transfection cells were washed with phos phate buffered saline PBS and fixed in methanol for 15 min at H1100220 C After one additional wash with PBS the cells were blocked with 0 2 gelatin in PBS for 2 h Slides were then incubated with a mixture of anti MHV M J1 3 and J2 7 monoclonal antibodies 12 and rabbit anti giantin antibodies for2hatroom temperature Cells were washed with 0 2 gelatin in PBS before incubation with fluorescein isothiocyanate labeled anti mouse and AlexaFluor labeled anti rab bit secondary antibodies Cells were washed extensively with PBS containing 0 2 gelatin and a final wash with PBS alone before being mounted in ProLong Gold antifade reagent Molecular Probes plus DAPI 4H11032 6H11032 diamidino 2 phe nylindole to stain nuclei Images were viewed by using an epifluorescence Nikon inverted microscope Nikon Inc Melville NY with MetaMorph imaging soft FIG 1 M protein hydrophilic tail and amino acid substitutions at R227 A A schematic illustrating the topological structure of the MHV A59 M protein is shown 27 The lumen and cytoplasmic sides correspond to inner and outer sides of the ERGIC Golgi membranes where MHV assembles B An alignment of M protein carboxy hy drophilic tails from representatives of group II MHV bovine corona virus BCV human coronavirus OC43 SARS CoV SARS group I TGEV feline infectious peritonitis FIPV human coronavirus 229E group III infectious bronchitis virus IBV was generated by CLUSTAL W 29 TGEV residues that were previously mapped to interact in vitro with the nucleocapsid are underlined 10 Positively and negatively charged amino acids are indicated above the sequences by plus and minus signs respectively C Amino acid substitutions and the corresponding codon changes introduced in place of R227 are indicated below the WT amino acid sequence of the hydrophilic do main 5340 VERMA ET AL J VIROL on May 24 2015 by UNIVERSITATSBIBLIOTHEK GIESSEN http jvi asm org Downloaded from ware Universal Imaging Corp Downingtown PA Images were processed by using Adobe Photoshop RESULTS Construction of charge substitution mutants at R227 To examine the importance of the positive charge at the penulti mate position in the carboxy tail of the MHV M protein R227 was changed to positively charged lysine K neutrally charged alanine A or the negatively charged residues aspartic acid D or glutamic acid E Fig 1 The effects of the mutations were analyzed for the ability of the mutant proteins to partic ipate in virus like particle VLP assembly and by reverse ge netics in the context of genetically engineered viruses using a full length MHV A59 infectious clone Effect of charge substitutions on M localization Initially the charge substitution mutants were expressed in BHK cells in parallel with the WT M protein to determine whether any of the changes affected normal cellular localization of the pro teins It is very well established that MHV M localizes to the Golgi 17 The WT and mutant proteins were expressed under the control of the chicken H9252 actin promoter using the pGAGGS vector and examined by immunofluorescence 25 Each mutant localized like the WT M protein in the Golgi Fig 2 Localization was confirmed by colocalization with the Golgi marker giantin This indicated that the charge substitutions do not affect the normal transport and localization of the protein Each of the mutant proteins also exhibited the same profile that is characteristic of the O linked glycosylated WT protein when they were examined by SDS PAGE and Western blotting Fig 3 Effect of charge substitutions on VLP assembly To deter mine whether the M mutants were competent to participate in assembly and release of VLPs each mutant protein was coex pressed with the WT E protein The proteins were expressed under the control of the T7 promoter using the vaccinia virus recombinant vTF7 3 that expresses T7 RNA polymerase 13 At 12 h p i the media were removed from cells and the cell TABLE 1 Primers used in this study Primer Sequence Genomic location Polarity Purpose R227A TTTAGATTAGGTTGCCAACAATGCGGTGTCCGC 29631 29663 Reverse R2273A mutation R227K TTTAGATTAGGTTTTCAACAATGCGGTGTCCGC 29631 29663 Reverse R2273K mutation R227D TTTAGATTAGGTATCCAACAATGCGGTGTCCGC 29631 29663 Reverse R2273D mutation R227E TTTAGATTAGGTTTCCAACAATGCGGTGTCCGC 29631 29663 Reverse R2273E mutation MHV M N H11001 CCACCTCTACATGCAAGGTGTTAAGC 29429 29454 Forward RT PCR MHV M N H11002 GGTCTGCCACAACCTTCTCTATCTG 31132 31156 Reverse RT PCR MHV E M H11001 CAGAACTGTCCAACAGGCCGTTAGCAAG 28626 28653 Forward RT PCR MHV E M H11002 GCAACCCAGAAGACACCTTCAATGC 30102 30126 Reverse RT PCR PackSignPCRFor TATTGACGTGTGCTGGAGTCAC 19951 19972 Forward RT PCR PackSignPCRRev CATAACCAGGTTTCCAGTCAGC 20852 20873 Reverse RT PCR Leader TATAAGAGTGATTGGCGTCCGTACGT 1 26 Forward RT PCR MHV M reverse CGGTACCTTTCATATCTATAC 29350 29370 Reverse Sequencing MHV G 4 reverse AGTCTGCTTTGGCTGATTCCTTC 29805 29827 Reverse Sequencing MHV 6 reverse TTCCTGAGCCTGTCTACG 30860 30877 Reverse Sequencing MHV 7 forward ATTCTGGTGGTGCTGATGAACC 30678 30699 Forward Sequencing MHV G8 forward GGCAGAAGCTCCTCTGTAAACC 29705 29726 Forward Sequencing E reverse CTCGTCGGCCGTCCATTGATAGAC 29001 29024 Reverse Sequencing PackSignSeqFor TTAAGAAGTGCCGGAATGG 20106 20124 Forward Sequencing PackSignSeqRev TGCTAGAGTCGTATGTCAC 20612 20630 Reverse Sequencing a Codon changes are indicated in boldface FIG 2 Localization of WT M and mutant proteins BHK 21 cells were transfected with the pCAGGS vector containing WT R227A R227D R227E or R227K M genes Cells were fixed and analyzed by immunofluorescence with mouse antibodies against M Colocalization of the proteins with the resident Golgi protein giantin is represented in the merged images by yellow Nuclei were stained with DAPI Fluo rescein isothiocyanate conjugated mouse and AlexaFluor 594 conju gated rabbit secondary antibodies were used to visualize the localiza tion of the M and giantin proteins respectively VOL 81 2007 CORONAVIRUS MEMBRANE PROTEIN 5341 on May 24 2015 by UNIVERSITATSBIBLIOTHEK GIESSEN http jvi asm org Downloaded from monolayers were lysed VLPs were isolated from clarified me dia by centrifugation through a sucrose cushion Cytoplasmic lysates and the extracellular pelleted material were analyzed by SDS PAGE and Western blotting Fig 3 All of the mutants were capable of forming VLPs as indicated by the presence of extracellular M The amount of extracellular M which is used as the indicator for VLPs 1 4 31 was compared to the total amount of intracellular plus extracellular M The K substitu tion appeared to have the least effect on the ability of the protein to participate in VLP assembly which suggests that the M protein with a positive charge at position 227 may be func tionally more competent to participate in assembly of VLPs The positive charge at position 227 is not absolutely re quired for virus production To examine the direct effect of the amino acid substitutions on virion assembly in the context of the virus R227 codon mutations were introduced into an MHV infectious clone 34 After electroporation viruses were readily recovered for both R227K and R227A mutants Both mutant viruses appeared to be phenotypically like the WT virus Multiple plaques were isolated from the mutant viruses and the WT control virus Total RNA was extracted from cells infected with passage 2 P2 of the plaque purified viruses and used as the template for RT PCR of the genome encompassing the M E and N genes Direct sequencing of amplified prod ucts showed that the introduced codon changes were present in each of the mutant viruses and that no additional changes were present in the remainder of the M gene or in the E and N genes Multiple plaque purified viruses were subsequently passaged three additional times in 17Cl1 cells Direct sequencing of RT PCR products amplified from the 3H11032 end of total viral RNA from cells infected with P5 viruses confirmed that the codon changes at position 227 were present No additional changes in the remainder of the M gene or in the N or E genes had arisen during passage of the viruses This indicates that the mutations were stably maintained Both mutants exhibited growth prop erties and plaque phenotypes essentially identical to parental infectious cloned MHV and WT MHV stock virus Fig 4 The results indicate that a positive charge is not absolutely required at amino acid position 227 A negative charge substitution in place of R227 has a sig nificant impact on virus growth In contrast to the R227K and R227A mutant viruses that were phenotypically like the WT virus the substitution of negatively charged D and E residues at position 227 had a drastically opposite effect Only a few small fusion foci were observed after electroporation of the mutants and no fusion was observed when the media off t