【病毒外文文献】2005 Detection of Severe Acute Respiratory Syndrome Coronavirus in the Brain_ Potential Role of the Chemokine Mig in Pat

Mig as a Mediator for Brain Damage Caused by SARS CID 2005 41 15 October 1089 MAJOR ARTICLE Detection of Severe Acute Respiratory Syndrome Coronavirus in the Brain Potential Role of the Chemokine Mig in Pathogenesis Jun Xu 1 Shuqing Zhong 1 Jinghua Liu 2 Li Li 1 Yong Li 1 Xinwei Wu 3 Zhijie Li 2 Peng Deng 2 Jingqiang Zhang 4 Nanshan Zhong 1 Yanqing Ding 2 and Yong Jiang 2 1 Guangzhou Institute of Respiratory Diseases 2 Key Laboratory of Functional Proteomics of Guangdong Province Southern Medical University 3 Guangzhou Center for Diseases Control and Prevention and 4 Electronic Microscope Center Sun Yatsen University Guangzhou People s Republic of China Background Previous studies have shown that common human coronavirus might be neurotropic although it was first isolated as a pathogen of the respiratory tract We noticed that a few patients with severe acute respiratory syndrome SARS experienced central nervous symptoms during the course of illness In the present study we isolated a SARS coronavirus strain from a brain tissue specimen obtained from a patient with SARS with significant central nervous symptoms Methods Using transmission electronic microscopy and nested reverse transcription polymerase chain reaction the causative pathogen was identified in cultures of a brain tissue specimen obtained from the patient with SARS Histopathologic examination of the brain tissue was performed using the methods of immunohistochemistry analysis and double immunofluorescence staining Fifteen cytokines and chemokines were detected in the blood of the patient with SARS by means of a bead based multiassay system Results A fragment specific for SARS human coronavirus was amplified from cultures of the brain suspension and transmission electronic microscopy revealed the presence of an enveloped virus morphologically compatible with a coronavirus isolated in the cultures Pathologic examination of the brain tissue revealed necrosis of neuron cells and broad hyperplasia of gliocytes Immunostaining demonstrated that monokine induced by interferon g Mig was expressed in gliocytes with the infiltration of CD68 monocytes macrophages and CD3 T lymphocytes in the brain mesenchyme Cytokine chemokine assay revealed that levels of interferon g inducible protein 10 and Mig in the blood were highly elevated although the levels of other cytokines and chemokines were close to normal Conclusions This study provides direct evidence that SARS human coronavirus is capable of infecting the central nervous system and that Mig might be involved in the brain immunopathology of SARS The causative pathogen of severe acute respiratory syn drome SARS has been identified as a new member of the coronavirus family that exhibits a broad range of hosts infecting many mammalian and avian species and causing upper respiratory gastrointestinal hepatic and CNS diseases 1 2 Two known human coronaviruses 229E and OC43 which cause up to one third of all cases of common cold were also found to infect the Received 21 February 2005 accepted 14 June 2005 electronically published 12 September 2005 Reprints or correspondence Dr Yong Jiang Key Laboratory of Functional Proteomics of Guangdong Province Dept of Pathophysiology Southern Medical University Tonghe Guangzhou 510515 People s Republic of China yjiang Clinical Infectious Diseases 2005 41 1089 96 H17050 2005 by the Infectious Diseases Society of America All rights reserved 1058 4838 2005 4108 0003 15 00 CNS 3 Our recent study of the SARS epidemic found that the spike protein a surface antigen determining the tropism of coronavirus had the strongest response to positive selection pressure 4 We noticed that a few patients with SARS in hospitals in Guangzhou City China exhibited central nervous symptoms during the course of their illnesses Lau and colleagues 5 reported that a CSF sample obtained from a 32 year old woman with SARS tested positive for SARS coronavirus SARS CoV by RT PCR indicating that SARS CoV might cause an infection in the CNS of patients with SARS In the present study we isolated a SARS CoV strain from a brain tissue specimen obtained during autopsy from a patient with SARS who became severely sick and showed significant central nervous symptoms dur ing the course of his illness Furthermore we investi gated the immunopathological mechanism of brain at Florida International University on June 14 2015 http cid oxfordjournals org Downloaded from 1090 CID 2005 41 15 October Xu et al damage in the patient with SARS In this study we detected a high level of monokine induced by IFN g Mig a member of CXC family 6 7 in the patient s brain and found that glio cytes were a major source for Mig production in the brain All results suggested that Mig was involved in the immunopath ology of the brain on invasion of SARS CoV CASE REPORT A 39 year old doctor who was in charge of treatment of patients with SARS in the respiratory intensive care unit of the Chest Hospital Guangzhou China developed a sudden onset of fever chills malaise headache dizziness and myalgia and was hospitalized on 2 April 2003 Physical examination showed a temperature of 38 5H11034C clear lungs and no obvious focus of infection His fever resolved with treatment with ribavirin and methylprednisolone dosage 120 mg per day and his con dition improved during the first week of treatment A chest radiograph obtained on day 11 after the onset of symptoms revealed left lower lobe infiltrates A complete blood count demonstrated an elevated WBC count of cells L an 9 16 4 H1100310 increased level of neutrophils cells L and lym 9 15 5H1100310 phopenia lymphocyte count cells L This suggests 9 0 4H1100310 that the condition of the patient with SARS was complicated by a secondary bacterial infection Treatment with methyl prednisolone was switched to 160 mg per 12 h intravenously coincident with the initiation of antibiotic therapy After ini tiation of the treatment mentioned above his condition grad ually improved during the fourth week after onset at which time a series of chest radiographs showed obvious resolution of the left lower lobe consolidation His total WBC count re turned to a normal level but lymphopenia still persisted Treat ment with methylprednisolone was then reduced to 40 mg per 12 h For the patient s complaint of obscured monocular vision eye ground examination was performed and revealed an exu dation around the visual yellow zone on day 26 after onset of illness 27 April Two days later the patient experienced pro gressive central nervous symptoms including dysphoria vom iting and deliria and was found to have progression of left lower lobe consolidation for which he was treated with non invasive ventilation and methylprednisolone at a dosage of 80 mg per 12 h coincident with initiation of treatment with cef tazidime Fortum Glaxo Wellcome and immunoglobulin De spite the management described above his condition deteri orated and a series of chest radiographs obtained during the fifth week after onset showed progressive bibasilar infiltration with severe leucopenia WBC count L lympho 9 0 86H1100310 penia lymphocyte count cells L and depressed 9 0 11H1100310 marrow After receiving intravenous sedative the patient developed coma on day 33 of illness after which he was transferred into the respiratory intensive care unit of the Guangzhou Institute of Respiratory Diseases Guangzhou China A CT scan of the brain revealed broad encephalic pathological changes of prob ably ischemia and necrosis and brain edema figure 1 By day 2 after admission to the Guangzhou Institute of Respiratory Diseases the patient developed breathness with slowing heart throb thus he underwent intubation and received mechanical ventilation His condition rapidly deteriorated he experienced multiorgan dysfunction syndrome and brain herniation oc curred He died on day 3 after his admission to the Guangzhou Institute of Respiratory Diseases 35 days after the onset of illness Serum specimens obtained from the patient at early and later phases of the illness were forwarded to the Centers for Disease Control and Prevention Guangzhou China where the diagnosis of SARS was confirmed by ELISA and indirect fluorescence assay 8 METHODS Autopsy materials Full autopsy was performed on the pa tients with SARS A detailed pathologic examination was per formed on the brain tissue obtained during autopsy A paraffin embedded block of the brain tissue was sectioned at a thickness of 5 mm and dewaxed according to standard procedures Immunohistochemistry and immunofluorescence staining Histopathologic evaluation was performed on the specimen of brain tissue obtained during autopsy Immunostaining was per formed with monoclonal antibodies to N protein of SARS CoV supplied as a gift from Dr Xiaoyan Che Zhujiang Hospital Southern Medical University China INF g inducible protein 10 IP 10 Abcam CD3 and CD68 DAKO and a polyclonal antibody to Mig Abcam To identify the cell type with ex pression of Mig double immunofluoresence staining was per formed with a primary polyclonal antibody to Mig plus a monoclonal antibody to glial fibrillary acidic protein Chem icon International and secondary goat antirabbit antibody conjugated with tetramethylrhodamine isothiocyanate and goat antimouse antibody conjugated with fluorescein isothiocyanate Sigma Aldrich Isolation and identification of SARS CoV We inoculated the suspension of the brain tissue onto 2 cell lines Vero e6 C1008 ATCC and human embryo lung fibroblast The initial cytopathic effect CPE was observed between days 3 and 5 The CPE was a refractive appearance of cell rounding followed by cell detachment and quickly spread to the entire cell mono layer within 24 48 h after the initiation of CPE Specimens were prepared for electronic microscopy by fixing a washed cell pellet with 2 5 glutaraldehyde and embedding it with epoxy resin RT PCR Nucleic acids were purified from the superna tants of cell cultures with CPE using a nucleic acid extraction kit Amplimedical SpA Bioline Division The cDNA synthesis from the extracted RNA was performed using a reverse tran at Florida International University on June 14 2015 http cid oxfordjournals org Downloaded from Mig as a Mediator for Brain Damage Caused by SARS CID 2005 41 15 October 1091 Figure 1 A CT scan of different brain sections shows a diffuse brain edema with multiple high density lesions A F Arrows high density lesions Table 1 Results of general laboratory examination of the patient with severe acute respiratory syndrome SARS by number of days after onset of illness Laboratory measurement Day after onset of SARS 1 112129313334 35 WBC count H1100310 9 cells L 4 72 16 40 5 87 21 01 7 01 3 41 1 51 0 86 Lymphocyte count H1100310 9 cells L 0 72 0 40 0 48 0 32 0 32 0 31 0 24 0 11 Neutrophil count H1100310 9 cells L 3 46 15 50 4 95 20 22 6 24 2 80 1 07 0 66 Platelet count H1100310 9 cells L 212 160 45 37 37 25 26 28 LDH level U L 151 326 208 458 464 465 521 1233 AST level U L 26 35 37 24 20 12 13 14 ALT level U L 32 103 86 60 43 30 29 28 CRP level mg L 2 9 124 1 24 9 298 6 278 0 306 7 418 0 417 8 NOTE ALT alanine aminotransferase AST aspartate aminotransferase CRP C reactive protein LDH lactate dehydrogenase scription kit Amplimedical SpA Bioline Division The pro cedure is based on the reverse transcription reaction utilizing the random primer technique A nested RT PCR was performed in accordance with the protocol developed by Dr Christian Drosten with outer primers 5 prime ATGAATTACCAAGTCAATGG TTAC 3 prime and 5 prime CATAACCAGTCGGTACAGCTA 3 prime and in nerprimers 5 prime GAAGCTATTCGTCACGTTCG 3 prime and 5 prime CTG TAGAAAATCCTAGCTGG AG 3 prime 8 Cytokine chemokine assay Quantification of multiple cy tokines chemokines was performed using a LiquiChip work station Qiagen GMBH which is a bead based system for immunoassays that allows simultaneous assays of multiple an alytes from a single sample 9 A blood sample obtained from the patients with SARS on the day before death was used for the cytokine chemokine assay The 15 cytokines chemokines assayed in this study included the following IL 1b IL 2 IL 4 IL 6 IL 8 IL 10 IL 12 TNF a IFN g granulocyte macro phage colony stimulating factor Mig IP 10 monocyte che moattractant protein 1 macrophage inflammatory protein 1a and regulated on activation normal T cell expressed and se at Florida International University on June 14 2015 http cid oxfordjournals org Downloaded from 1092 CID 2005 41 15 October Xu et al Figure 2 Histochemistry stains showing neuron denaturation and necrosis with striated encephalomalacia A original magnification H11003100 B original magnification H11003400 vasocongestion with widening peripheral space the around vessel C original magnification H11003200 and focal hemorrhage D original magnification H11003100 and gliosome formation in the brain tissue E original magnification H11003200 Arrows pathological alterations described above creted RANTES Serum samples were obtained from 10 healthy control subjects aged 22 51 years Samples were ana lyzed on the LiquiChip system Qiagen GMBH according to the manufacturer s instruction Approval of the local ethics committees and informed consent were obtained RESULTS General laboratory examination General laboratory ex amination revealed a peak C reactive protein level of 418 0 mg L and an increase in the lactate dehydrogenase level to 1233 0 U L between days 1 and 35 after the onset of illness Detailed information is shown in table 1 Histopathologic examination Histopathologic examina tion revealed invasive Aspergillus pneumonia with multiple ab scess constitutional diffuse mycohemia and fungal multi abscess in multiple organs Pathologic examination of the brain tissue specimen under microscope revealed neuron denatura tion and necrosis broad gliocytes hyperplasia with gliosome formation and encephalic edema figure 2 Identification of SARS CoV in the brain The result of the nested RT PCR showed that a predicted cDNA fragment BNI 1 of 108 bp specific for SARS CoV 8 was amplified from Vero E6 cell culture inoculated with the brain suspension but not from the culture that included medium only figure 3A Examination by transmission electronic microscopy re vealed the presence of enveloped virus particles with a diameter of 80 90 nm and a surface morphology compatible with a coronavirus figure 3B in the culture showing CPE 8 Immunohistochemistry and double immunofluoresence staining Immunohistochemistry staining of gliocytes and neurocytes obtained from the brain of the patient with SARS revealed them to be positive for N proteins figure 4A but those obtained from a patient who died in a traffic accident were not figure 4B We found that Mig but not IP 10 ex pressed with infiltration of CD68 monocytes macrophages and CD3 T lymphocytes in the brain mesenchyme of the patient Double immunofluoresence staining revealed that Mig was mainly expressed in gliocytes figure 5 at Florida International University on June 14 2015 http cid oxfordjournals org Downloaded from Mig as a Mediator for Brain Damage Caused by SARS CID 2005 41 15 October 1093 Figure 3 Identification of severe acute respiratory syndrome SARS coronavirus SARS CoV in the brain tissue of the patient with SARS A Results of nested RT PCR for BNI 1 fragment 108 base pairs of SARS CoV in the supernatants obtained from cultured Vero E6 cells with cytopathic effect Lane 1 DNA standard lane 2 Vero E6 cell culture inoculated with the lung suspension lane 3 Vero E6 cell culture used as negative control lane 4 Vero E6 cell culture inoculated with the brain suspension B Transmission electronic microscopy reveals the presence of enveloped virus particles with morphology compatible with coronavirus Extracellular particles were found clustering and adhering to the surface of the plasma membrane Figure 4 Immunohistochemistry stains for N protein of severe acute respiratory syndrome SARS coronavirus SARS CoV in a specimen of brain tissue obtained from the patient with SARS during autopsy A monoclonal antibody against N protein of SARS CoV and the secondary antibody of horseradish peroxidase HRP conjugated goat antimouse were used for the immunohistochemical staining of brain tissue specimens obtained from the patient with SARS A original magnification H11003200 and a patient who died in a traffic accident B original magnification H11003200 Staining was performed with diaminobenzidine brown Arrows positive staining cells Cytokine chemokine profile in the blood As shown in figure 6 the levels of IL 1b IL 2 IL 4 IL 6 IL 8 IL 10 IL 12 TNF a IFN g granulocyte macrophage colony stimulat ing factor RANTES macrophage inflammatory protein 1a and monocyte chemoattractant protein 1 were close to those of the control subjects but the levels of IP 10 and Mig in the blood of the patient with SARS were highly elevated DISCUSSION On review of the patient s vital record we found that his general condition was nearly normal and a chest radiograph showed resolving left lower pulmonary infiltration when he developed initial central nervous symptoms with an exudation around the visual yellow zone indicating that the pathologic change in the brain was independent of pulmonary superinfection in the pa tient In addition to findings of CT scanning indicating brain damage pathologic examination revealed gliocytes hyperplasia neuron denaturation and necrosis combined with a striated encephalomalacia suggesting that a chronic progressive viral cerebritis was present in the patient during the course of illness Neuroinvasion by SARS CoV was also directly evidenced by the viral morphology observed under electronic microscope genetic identification and the viral antigen N protein found in the brain Previous studies found that coronavirus might be neuro tropic neuroinvasive and neurovirulent although it was first isolated as a pathogen of the respiratory tract 1 3 At least 3 routes including olfactory nerve a hematogenous route and lymphatic systems could be used by coronavirus to gain access to the CNS 10 12 The cell lines of astrocytoma neuroblas toma neuroglioma and oligodendrocyte were all susceptible to the infection of human coronaviruses 13 16 Mouse hep atitis virus a murine coronavirus has been found to induce demyelinating disease of the CNS 17 18 Moreover Glass and colleagues 19 recently reported a model of SARS CoV at Florida International University on June 14 2015 http cid oxfordjournals org Downloaded from 1094 CID 2005 41 15 October Xu et al Figure 5 Immunohistochemistry and double immunofluoresence staining of specimens of brain tissue sections obtained from the patient with severe acute respiratory syndrome during autopsy Antibodies against IFN g inducible protein 10 IP 10 A original magnification H11003200 monokine induced by IFN g Mig B original magnification H11003200 CD68 C original magnification H11003200 and CD3 D original magnification H11003200 were used in the immunohistochemical staining Antibodies against Mig E original magnification H11003400 and glial fibrillary acidic protein F original magnification H11003400 were used in double immunofluoresence staining A Brain tissues without evidence of IP 10 from staining B Mig positive staining cells detected in the brain tissue C Infiltration of CD68 monocyte macrophage cells D A few CD3 T lymphocytes E G A double immunofluoresence stain showing that glial fibrillary acidic protein positive cells F were expressing Mig E and displaying yellow immunofluoresence G original magnification H11003400 when the 2 images were merged Arrows positive staining cells A D were stained by diaminobenzidine E G were stained by both tetramethylrhodamine isothiocyanate red and FITC green respectively infection in C57BL 6 mice that demonstrated that SARS CoV was able to infect the brain The finding that SARS CoV in fected the brain of the patient with SARS was consistent with findings of previous reports on neuroinvasion of the corona virus family 13 19 Genomic compa