【病毒外文文献】2006 Functional Characterization of Heptad Repeat 1 and 2 Mutants of the Spike Protein of Severe Acute Respiratory Syndr

JOURNAL OF VIROLOGY Apr 2006 p 3225 3237 Vol 80 No 7 0022 538X 06 08 00H110010 doi 10 1128 JVI 80 7 3225 3237 2006 Copyright 2006 American Society for Microbiology All Rights Reserved Functional Characterization of Heptad Repeat 1 and 2 Mutants of the Spike Protein of Severe Acute Respiratory Syndrome Coronavirus Woan Eng Chan 1 Chin Kai Chuang 2 Shiou Hwei Yeh 3 Mau Sun Chang 4 and Steve S L Chen 1 Institute of Biomedical Sciences Academia Sinica Taipei 11529 1 Division of Biotechnology Animal Technology Institute Taiwan Miaoli 35099 2 Department of Microbiology National Taiwan University College of Medicine Taipei 10051 3 and Department of Medical Research Mackay Memorial Hospital Taipei County 25115 4 Taiwan Republic of China Received 24 October 2005 Accepted 13 January 2006 To understand the roles of heptad repeat 1 HR1 and HR2 of the spike S protein of the severe acute respiratory syndrome coronavirus SARS CoV in virus cell interactions the conserved Leu or Ile residues located at positions 913 927 941 and 955 in HR1 and 1151 1165 and 1179 in HR2 were individually replaced with an H9251 helix breaker Pro residue The 913P mutant was expressed mainly as a faster migrating lower molecular weight S L form while the wild type and all other mutants produced similar levels of both the S L form and the slower migrating higher molecular weight S H form The wild type S L form was processed to the S H form whereas the S L form of the 913P mutant was inefficiently converted to the S H form after biosynthesis None of these mutations affected cell surface expression or binding to its cognate ACE2 receptor In a human immunodeficiency virus type 1 SARS S coexpression study all mutants except the 913P mutant incorporated the S H form into the virions as effectively as did the wild type S H form The mutation at Ile 1151 did not affect membrane fusion or viral entry The impaired viral entry of the 927P 941P 955P and 1165P mutants was due to their inability to mediate membrane fusion whereas the defect in viral entry of the 1179P mutant occurred not at the stage of membrane fusion but rather at a postfusion stage Our study demonstrates the functional importance of HR1 and HR2 of the SARS CoV spike protein in membrane fusion and viral entry The severe acute respiratory syndrome coronavirus SARS CoV the etiologic agent of the outbreak of atypical pneumo nia known as SARS is a membrane enveloped virus which encodes a 29 727 nucleotide polyadenylated positive strand RNA The genome of this virus contains five major open read ing frames that encode the replicase polyprotein the spike S envelope E and membrane M glycoproteins and the nu cleocapsid N protein in the same order and of approximately the same sizes as those of other CoVs 34 39 In CoVs the structural proteins S E M and N play crucial roles during host cell entry and virion morphogenesis assembly and budding The S protein is incorporated into the viral envelope by interaction with the M protein and forms large spikes on virion surfaces and mature virions are released from smooth vesicles 20 The S protein of CoVs which is oligomerized in the endo plasmic reticulum is N glycosylated and has an apparent mo lecular mass of 150 to 180 kDa reviewed in reference 28 The S1 domain is required for binding to specific cellular receptors thus defining the host range of the virus Angiotensin convert ing enzyme 2 ACE2 has been shown to be a physiologically relevant functional receptor for the SARS CoV 31 SARS CoV S protein mediated viral infection can be effectively blocked by either a soluble form of ACE2 anti ACE2 anti bodies or an antibody recognizing the ACE2 binding domain of the S protein 31 44 The S2 domain forms the membrane anchored stalk region and mediates the fusion between the viral and cellular membranes 39 55 The S protein mediated entry of the SARS CoV into host cells occurs via a pH depen dent endocytic pathway 24 41 59 although S mediated cell to cell fusion can occur at a neutral pH 31 41 55 Membrane enveloped viruses have evolved a similar mode of entry to ensure that their viral genomes are properly trans located into host cells Class I fusion proteins including hem agglutinin 2 HA2 in influenza viruses gp41 in the human immunodeficiency virus HIV simian immunodeficiency virus SIV GP2 in the Ebola virus and F2 in paramyxoviruses 17 23 are characterized by an N terminal heptad repeat 1 HR1 adjacent to the fusion peptide which is just C terminal to the cleavage site or is near the N terminus of the fusion protein and a C terminal HR2 which is close to another short spacer and the transmembrane domain These HR sequences play important roles in membrane fusion and viral entry reviewed in references 17 23 and 42 For viruses such as the influenza virus 6 virions are internalized after HA1 induced receptor binding and receptor mediated endocytosis the low pH within the endosomes induces a major structural rearrangement of HA and the transition from the metastable nonfusogenic to the active fusogenic prehairpin intermediate of HA triggers membrane fusion Such structural switching also includes the conversion of a part of the HR region of HA2 which forms a nonhelical loop in its native state 53 into a pH induced fusogenic coiled coil structure 6 This conformational change is also the basis of the spring loaded mechanism for activa tion of viral fusion 8 Formation of the six helix bundle po sitions both the N terminal fusion peptide and C terminal transmembrane domain on the same site of a stable protein rod and exposes the fusion peptide to target cell membranes placing the cellular endosomal and viral membranes in close proximity to promote formation of a fusion pore In both the HIV and SIV binding to CD4 and its coreceptor triggers Corresponding author Mailing address Institute of Biomedical Sciences Academia Sinica 128 Yen Chiu Yuan Road Section 2 Nan kang Taipei 11529 Taiwan Republic of China Phone 886 2 2652 3933 Fax 886 2 2785 8847 E mail schen ibms sinica edu tw 3225 on March 25 2015 by guest http jvi asm org Downloaded from conformational changes in the noncovalent gp120 gp41 oligo meric complex present on the viral envelope which then acti vate the pH independent viral fusion process 3 7 9 33 46 50 52 Despite the fact that the SARS CoV S protein shares little amino acid similarity with other CoVs the putative S2 domain of the SARS CoV also contains two predicted amphipathic H9251 helical 4 3 heptad repeat sequences characteristic of coiled coils The sequences most homologous to the SARS CoV are the mouse hepatitis virus and bovine CoV Because it shares several features with other class I fusion protein mediated membrane fusion elements the six stranded coiled coil struc ture of the mouse hepatitis virus 5 56 can be used as a model to study the SARS CoV S protein Recent studies based on peptide modeling have shown that the HR1 and HR2 frag ments of the SARS CoV S protein form a stable six helix bundle structure 4 26 32 47 58 60 61 The three dimen sional structure revealed by X ray crystallography confirms that the fusion core of the SARS CoV S protein is a six helix bundle with three HR2 helices packed against the hydrophobic grooves in an oblique antiparallel manner on the surface of a central coiled coil formed by three parallel HR1 helices 45 57 The hairpin trimer structure of the SARS CoV S protein suggests that these regions are involved in the membrane fu sion process and that this structure may represent a postfusion conformation of the core The observations that synthetic pep tides corresponding to the HR motifs possess inhibitory activ ity against viral fusion 4 32 57 60 61 support this hypoth esis Follis et al recently reported that Ser substitutions for the hydrophobic residues at the a and d positions within the short H9251 helical segment of HR2 but not in the outlying extended chain in the core structure affect the cell to cell fusion ability of the S protein 18 Nevertheless the precise roles of HR1 and HR2 motifs in the context of virus infection remain to be determined To elucidate the functional basis of the HR1 and HR2 mo tifs in S protein mediated virus cell interactions in the present study we conducted mutagenesis analyses by substituting a Pro residue which disrupts the H9251 helical structure more severely than any other amino acids for the HR conserved Leu or Ile residues located at positions 913 927 941 and 955 in HR1 and 1151 1165 and 1179 in HR2 based on a codon optimized S gene We developed sensitive membrane fusion assays based on the loxP Cre recombination system of bacteriophage P1 and the HIV 1 Tat long terminal repeat LTR transactivation system to monitor membrane fusion of these mutants We also employed an HIV SARS S phenotypic infectivity assay to de termine mutant S mediated viral entry The results revealed that the defect in viral entry of the 927P 941P 955P and 1165P mutants is due to their impaired membrane fusion abil ity and that the impaired viral entry of the 1179P mutant is not due to a blockage in membrane fusion but rather to a defect at a postfusion stage Our study demonstrates for the first time the direct role of H9251 helices of HR1 and HR2 in membrane fusion and viral entry MATERIALS AND METHODS Cells and antibodies Human embryonic kidney 293T and Vero E6 cells were cultured in Dulbecco s modified Eagle s medium supplemented with 10 heat inactivated fetal bovine serum Hybridoma 183 clone H12 5C was described previously 29 Rabbit anti SP4 was generated by immunizing rabbits with res idues 435 to 454 of the S protein 12 Rabbit anti S protein antiserum was prepared by immunizing rabbits with a bacterially expressed recombinant soluble S protein residues 511 to 1255 25 A monoclonal antibody MAb directed against ACE2 was purchased from R 927P 5H11032 ACCAGCACGGCCCCAGGCAAGCTGCAGGA CGTGG 3H11032 sense and 5H11032 CTGCAGCTTGCCTGGGGCCGTGCTGGTCGT GG 3H11032 antisense 941P 5H11032 AACGCCCAGGCCCCTAACACCCTGGTGAAG CAGC 3H11032 sense and 5H11032 CACCAGGGTGTTAGGGGCCTGGGCGTTCTGG TTG 3H11032 antisense 955P 5H11032 AACTTCGGCGCCCCAAGCTCCGTGCTGAA CGATATC 3 sense and 5H11032 CAGCACGGAGCTTGGGGCGCCGAAGTTGC TGGAC 3H11032 antisense 1151P 5H11032 GACCTGGGCGACCCTAGCGGCATCAA CGCCAGCG 3H11032 sense and 5H11032 GTTGATGCCGCTAGGGTCGCCCAGGTC CACGTCC 3H11032 antisense 1165P 5H11032 ATCCAGAAGGAGCCAGACCGCCTG AACGAGGTGG 3H11032 sense and 5H11032 GTTCAGGCGGTCTGGCTCCTTCTGG ATGTTCACG 3H11032 antisense and 1179P 5H11032 CTGAACGAGAGCCCTATCGA CCTCCAGGAGCTGGG 3H11032 sense and 5H11032 CTGGAGGTCGATAGGGCTCT CGTTCAGGTTCTTGG 3H11032 antisense The underlined nucleotides mark the respective sense and antisense primer Pro substitutions Primers OptiS2743 5H11032 CAACAACGTGTTCCAGACCC 3H11032 and OptiS3210 5H11032 CTTCAACTTCA GCCAGATCC 3H11032 were used to sequence the DNA fragments containing HR1 mutations and primer OptiS4154 5H11032 TCATCACCACGGACAACACC 3H11032 was used to sequence the DNA fragments containing HR2 mutations pCAGGS MCS was constructed by replacing the 1 kb PstI to EcoRV coding region of pCAGGS NLS Cre with a synthetic oligonucleotide linker 5H11032 CTGC AGGAATTCTCGAGCTCACGCGTGCATGCGATATC 3H11032 which contained the PstI EcoRI XhoI SacI MluI Sph EcoRV recognition sequence The SalI site at the 5H11032 boundary of the cytomegalovirus immediate early 1 enhancer was then replaced by an oligonucleotide containing the SalI NotI XbaI sites and the HindIII site at the 3H11032 boundary of the poly A signal was replaced by the NotI site Therefore the entire expression cassette could be easily isolated using NotI digestion ploxP1 derived from pBluescript SKII contained two tandem repeats of the 34 bp loxP sequence in multiple cloning sites To generate ploxP EGFP loxP ploxP1 was codigested with SalI and NheI followed by Klenow fill in The 1 15 kb KpnI to SspI fragment encoding the enhanced fluorescence green pro tein EGFP and poly A sequences of pIRES EGFP Clontech was blunt ended by T4 DNA polymerase and then inserted into the treated ploxP1 vector by blunt end ligation The XhoI EcoRV fragment containing the EGFP gene flanked at both ends by loxP sequences was then isolated and inserted into the same restriction enzyme sites in pCAGGS MCS to create pCAGGS loxP EGFP loxP The 0 7 kb BamHI to NotI fragment of pDsRed2 N1 Clontech was blunt ended by fill in with the Klenow fragment and was then inserted into the EcoRV site of pCAGGS loxP EGFP loxP to obtain pCAGGS loxP EGFP loxP DsRed2 pCDNA3 1 H11002 ACE2 Ig was generated by replacing the EcoRI to KpnI frag ment in pCDNA3 1 H11002 ACE2 with a PCR product encoding the Fc domain of a human immunoglobulin H92531 IgH92531 heavy chain The insert was generated using 5H11032 TGAATTCACCAGCACCTGAACTCCTGG 3H11032 and 5H11032 TGGTACCTCATT TACCCGGGGACAGGGAGAGG 3H11032 as the primers and p2C11 H92531 which en 3226 CHAN ET AL J VIROL on March 25 2015 by guest http jvi asm org Downloaded from codes a human IgG1 Fc domain as the template in PCR The resultant plasmid encoded a fusion protein containing the CH2 and CH3 sequences of the Fc domain beginning with Pro Ala Pro Glu and ending with Gly Lys Val Asp at tached at the C terminus of Ser 602 within the ectodomain of ACE2 To con struct pCAGGS ACE2 Ig pCDNA3 1 H11002 ACE2 Ig was digested with XbaI blunt ended with the Klenow fragment and cut by KpnI to obtain the ACE2 CH2 CH3 fusion gene The pCAGGS MCS vector was digested by EcoRI and treated with the Klenow enzyme to fill in the staggered end before KpnI diges tion Then the ACE2 CH2 CH3 DNA fragment was inserted into the treated pCAGGS MCS vector to obtain pCAGGS ACE2 Ig Transfection of DNA plasmids For expression of the SARS S protein 293T cells grown on 6 or 10 cm petri dishes were transfected with 3 or 10 H9262gofthe codon optimized wild type wt and mutant pCDNA3 1 H11002 S constructs by a standard calcium phosphate coprecipitation method 14 For the one cycle viral replication assay 293T cells grown in 10 cm petri dishes were cotransfected with 10 H9262g of pNL4 3R H11002 E H11002 Luc and 12 H9262g of either the wt or mutant pCDNA3 1 H11002 S plasmids Alternatively cells were cotransfected with 10 H9262g of pHXBH9004BglCAT and 7 5 H9262g of either the wt or mutant S plasmids pCDNA3 which was added to the transfection mixture that did not contain S expression plasmids was used as a negative control Virus preparation and Western blot analysis Two days after transfection cell free virions were isolated through a 20 sucrose cushion as described previously 13 and equal volumes of cell and viral lysates were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS PAGE and Western blotting The membrane blots were incubated with the appropriate primary and secondary antibodies followed by enhanced chemiluminescence detection Assessment of the ACE2 binding ability of the S proteins 293T cells grown on 6 cm dishes were cotransfected with 2 H9262g of either the wt or mutant pCDNA3 1 H11002 S plasmids together with 2 H9262g of pCAGGS ACE2 Ig using the Lipofectamine trans fection reagent Invitrogen Carlsbad CA according to the procedures provided by the manufacturer Two days after transfection cells were washed with phosphate buffered saline PBS and then lysed in 200H9262l of PBS containing 1 3 3 cholamido propyl dimethylammonio 1 propanesulfonate CHAPS and protease inhibitor cocktail Roche on ice for 30 min followed by centrifugation to remove cell debris Equal volumes of cell lysates were incubated with protein A Sepharose 4B beads After extensive washes with PBS containing 0 5 CHAPS the bound proteins were analyzed by Western blotting using an ACE2 MAb and rabbit anti S antiserum to detect ACE2 and the S protein respectively Alternatively culture supernatants collected from 293T cells transfected with pCDNA3 1 H11002 ACE2 ecto were concen trated by Amicon Centriprep YM 10 membranes Millipore Bedford MA 293T cells transfected with each of the wt and mutant S plasmids were lysed with PBS containing 1 3 3 cholamidopropyl dimethylammonio 2 hydroxy 1 propane sulfonate CHAPSO and protease inhibitor cocktail The cell lysates were then incubated with concentrated soluble ACE2 at 4 C for 2 h followed by incubation with rabbit anti S coated protein A Sepharose 4B beads at 4 C overnight After being washed extensively with PBS containing 0 5 CHAPSO the immune com plexes were analyzed by SDS PAGE followed by Western blotting using rabbit anti S and anti ACE2 MAb to detect precipitated S and ACE2 proteins SARS S protein mediated membrane fusion To prepare effector cells for qualitative analysis of S mediated membrane fusion 293T cells grown on 6 cm petri dishes were cotransfected by the Lipofectamine transfection method with 3 H9262g of either the wt or mutant pCDNA3 1 H11002 S plasmids and 1 H9262g of pCAGGS NLS Cre For preparation of target cells 293T cells grown on two 10 cm dishes were cotransfected with 6 H9262g of pCDNA3 1 H11002 ACE2 and 4 H9262g of pCAGGS loxP EGFP loxP DsRed2 One day after transfection PBS washed transfected cells were trypsinized and 6 H11003 10 5 each of the effector and target cells were seeded onto 6 cm dishes and then cocultured for 2 days Cocultured cells were examined under a Zeiss model 135 inverted fluorescence microscope Carl Zeiss AG Germany and green and red fluorescent images were overlaid For quan titative membrane fusion analysis effector cells were cotransfected with 4 H9262gof the wt or mutant S expression plasmids and 2 5 H9262g of a cytomegalovirus pro moter driven HIV 1 Tat expression plasmid pCEP4 tat and target cell were cotransfected with 10 H9262g of pCDNA3 1 H11002 ACE2 and 5 H9262g pIIIexcat a chlor amphenicol acetyltransferase cat gene linked to the HIV 1 LTR by the calcium phosphate coprecipitation method On the following day effector and target cells were trypsinized and 6 H11003 10 5 of each kind of cell were cocultured Two days after coculturing cells were harvested for CAT activity measurement HIV SARS S pseudotype infection assay One day before pseudotype infec tion 3 H1100310 4 or 1 5 H11003 10 5 Vero E6 cells were seeded onto 24 well plates for the luciferase assay or 6 well dishes for the CAT assay respectively Cell free NL4 3R H11002 E H11002 Luc or HXBH9004BglCAT pseudotypes containing 6 H11003 10 4 or 10 5 cpm of reverse transcriptase RT activity in 0 6 or 2 ml respectively of Dulbecco s modified Eagle s medium containing 2 5 fetal bovine serum in the presence of 8 H9262g ml of Polybrene were added to the wells After centrifugation at 2 200 rpm for2hatroom temperature the cultures were incubated at 37 C Two days after transfection cells were harvested and prepared for the luciferase or CAT assay RT luciferase and CAT assays Cell free SARS S protein pseudotyped vi ruses were assayed for virion associated RT activity as described previously 13 14 Cell lysates 25 H9262l prepared from NL4 3R H11002 E H11002 Luc pseudotype infection were assayed for firefly luciferase activity using 50 H9262l of luciferase assay substrate reagent Promega Cell extracts prepared from an HXBH9004BglCAT pseudotype infection were assayed for CAT activity using a Packard Instant Imager model A202401 Packard Instrument Company Meriden CT as described previously 14 Binding of HIV SARS S pseudotypes to ACE2 expressing cells The wt and mutant pseudotypes produced as described above were concentrated by an Amicon Ultra 15 filter with a nominal molecular mass limit of 100 kDa Millipore and comparable amounts of wt and mutant pseudotypes containing 10 6 cpm of RT activity were incubated with 293T cells transfected with pCDNA3 1 H11002 ACE2 at 4 C for 1 h After being washed three times with PBS containing 0 5 bovine serum albumin BSA cells were blocked with PBS containing 2 BSA on ice for 30 min The cells were successively incubated with rabbit anti S and fluorescein isothiocyanate conjugated anti rabbit IgG on ice After each antibody incuba tion the cells were washed three times with ice cold PBS containing