【病毒外文文献】2014 Coronavirus MHV-A59 infects the lung and causes severe pneumonia in C57BL_6 mice

WIV CAS and Springer Verlag Berlin Heidelberg 2014 DECEMBER 2014 VOLUME 29 ISSUE 6 393 RESEARCH ARTICLE Coronavirus MHV A59 infects the lung and causes severe pneumonia in C57BL 6 mice Zhangsheng Yang 1 Jun Du 2 Gang Chen 1 Jie Zhao 1 Xuanming Yang 1 Lishan Su 3 Genhong Cheng 4 Hong Tang 1 1 Key Laboratory of Infection and Immunity CASKLII Institute of Biophysics Chinese Academy of Sciences 15 Datun Road Chaoyang District Beijing 100101 China 2 Key Laboratory of Chemical Biology and Molecular Engineering of Ministry of Education Institute of Biotechnology Shanxi University Taiyuan 030006 China 3 Department of Microbiology and Immunology and Lineberger Comprehensive Cancer Center University of North Carolina at Chapel Hill School of Medicine NC 27599 7295 USA 4 Department of Microbiology Immunology and Molecular Genetics University of California Los Angeles CA 90095 USA It remains challenging to develop animal models of lung infection and severe pneumonia by severe acute respiratory syndrome coronavirus SARS CoV and Middle East respiratory syndrome cornavirus MERS CoV without high level of containment This inevitably hinders understanding of virus host interaction and development of appropriate countermeasures Here we report that intranasal inoculation of sublethal doses of murine coronavirus mouse hepatitis virus A 59 MHV A59 a hepatic and neuronal tropic coronavirus can induce acute pneumonia and severe lung injuries in C57BL 6 mice Infl ammatory leukocyte infi ltrations hemorrhages and fi brosis of alveolar walls can be observed 2 11 days after MHV A59 infection This pathological manifestation is associated with dramatical elevation of tissue IP 10 and IFN and moderate increase of TNF and IL 1 but inability of anti viral type I interferon response These results suggest that intranasal infection of MHV A59 would serve as a surrogate mouse model of acute respiratory distress syndrome by SARS CoV and MERS CoV infections KEYWORDS coronavirus MHV A59 pneumonia infl ammation cytokine Received 2 November 2014 Accepted 10 December 2014 Published online 22 December 2014 Correspondence Phone 86 27 87197727 Email tanghong VIROLOGICA SINICA 2014 29 6 393 402 DOI 10 1007 s12250 014 3530 y INTRODUCTION Two novel betacoronaviruses severe acute respiratory syndrome coronavirus SARS CoV and Middle East respiratory syndrome coronavirus MERS CoV have emerged in humans in this century and both of which cause acute respiratory distress syndrome ARDS with high morbidity and mortality rates Graham R L et al 2013 Both viruses are believed to originate in different bat species Chan J F et al 2012 Ge X Y et al 2013 Lau S K et al 2005 Li W et al 2005 Zaki A M et al 2012 and have the potential to rapidly adapt and stably transmit to new species Graham R L et al 2013 The patients with SARS are characterized by rapidly progres sive pneumonia The early symptoms are universal fever myalgia malaise and late symptoms are cough dyspnea tachypnea pleurisy and tendency of diarrhea Most of the patients deteriorate to persistent fever with increased dyspnea and oxygen desaturation Peiris J S et al 2003 Severe histopathological alterations are evident in lung including congestion edema diffuse alveolar damage desquamation of pneumocytes inflammatory infi ltrates with hyaline membrane formation and intersti tial thickening DeAlbuquerque N et al 2006 Nicholls MHV A59 induces acute lung injuries VIROLOGICA SINICA394 DECEMBER 2014 VOLUME 29 ISSUE 6 J M et al 2003 SARS patients show typical elevation of serum IFN IL 10 CXCL10 IP10 CCL5 and CXCL 8 IL 8 Ward S E et al 2005 Considering these extensive zoonotic reservoir and ten dency to emerge as highly pathogenic human pathogens it is therefore of high priority to establish valid animal mod els to understand virus host interactions for drug and vac cine development A line of animal models for SARS have been developed Day C W et al 2009 De Albuquerque N et al 2006 DeAlbuquerque N et al 2006 Frieman M et al 2012 Leibowitz J L et al 2010 Ma X Z et al 2010 Roberts A et al 2007 ever since the first out break of SARS CoV Drosten C et al 2003 Ksiazek T G et al 2003 Osterhaus A D et al 2004 Peiris J S et al 2003 owing to the cross reactivity of spike protein with mouse ACE2 receptor orthologue Closely recapitulating the clinical pathological manifestations in a progression is toward pneumonitis and diffused alveolar injury but viremia is rare and transient Moreover SARS CoV tends to adapt to mouse with elevated disease severity and mortality MERS CoV can transiently infect rhesus macaques with mild to moderate illness Munster V J et al 2013 and common marmoset with severe pneumonia but absence of pulmorary fibrosis Falzarano D et al 2014 Mice and hamsters are not permissive to MERS CoV due to lack of cognate receptor Coleman C M et al 2014 de Wit E et al 2013 A humanized mouse model of MERS CoV infection has been developed by trans duction with an adenoviral vector expressing the human receptor of the virus dipeptidyl peptidase 4 Zhao J et al 2014 However the requirements of ABSL3 level of containment and restricted license to conduct effec tive research further hinder the use of animal models for SARS CoV and MERS CoV infection Mouse hepatitis viruses A59 MHV A59 is a member of subgroup 2a of betacoronavirus closely relating to human coronavirus HcoV OC43 in the same subgroup and SARS CoV in subgroup 2b Graham R L et al 2013 Snijder E J et al 2003 A large body of evidence have associated pathologies with MHV A59 infection including hepatitis Kim K D et al 2007 Weiss S R et al 2005 Zhao J et al 2008 autoimmune hepa titis like disease Aparicio J L et al 2011 thymus involution Godfraind C et al 1995 hypergamma globulinaemia Coutelier J P et al 1987 and transient demyelination Lavi E et al 1986 Whether MHV A59 can infect respiratory tract and cause pathological mani festation similar to SARS CoV infection remains elusive Of note MHV A59 antigens can be detected in lung and disseminate to other tissues after neonatal Swiss mice are infected intranasally Barthold S W et al 1984 Unfortunately pathology has not been documented even in the immune compromised newborns To test whether MHV A59 can infect the lungs we intranasal inoculated C57BL 6 mice with MHV A59 We found that MHV A59 replicated in the lung and in duced acute pneumonia which closely mimicked ARDS by SARS CoV and MERS CoV in human lungs This mouse model therefore may benefit further studies of pathogenesis of coronaviruses infection in human respi ratory tracts MATERIALS AND METHODS Cells Viruses and mice Murine cell line 17Cl 1 was provided by Dr K Holmes University of Colorado Health Sciences Center US and immortalized wild type MEF cells in C57BL 6 back ground were original from ATCC were maintained in the medium of Dulbecco s modifi ed Eagle medium DMEM supplemented with 10 heat inactivated fetal bovine serum FBS and antibiotics 100 g mL penicillin and 100 g mL streptomycin at 37 C in the incubator HERAcell 240 with the presence of 5 CO 2 Mouse hepatitis virus A59 strain MHV A59 was propagated according to the method described previ ously Schaad M C et al 1990 Briefl y the virus was propagated in 17Cl 1 cells followed by 3 cycles of freez ing and thawing the large debris was spun down and the supernatant was used as a stock solution The titer of the virus was determined by plaque assay in 17Cl 1 cells ex actly as described Schaad M C et al 1990 Sendai Virus SeV was obtained from Wuhan Institute of Virology Chinese Academy of Sciences China and expanded in day 10 SPF embryonate eggs and titrated with hemagglutination assay HA as described previous ly Zheng D et al 2008 The HA tier of SeV stock was 1 256 and for the infection of MEF cells 1 25 was used C57BL 6 mice were purchased from Beijing Laboratory Animal Research Center Beijing China All mice were maintained in animal facilities under specific pathogen free conditions The handling of mice and experimental procedures were approved by the Animal Welfare and Research Ethics Committee of the Institute of Biophysics Chinese Academy of Sciences Animal infection 4 week old C57BL 6 mice were anesthetized intraper itoneally i p with pentobarbital sodium combined with chloral hydrate and then inoculated intranasally i n with 10 L of MHV A59 virus at 1 5 10 5 or 1 5 10 4 plaque forming unit PFU and control mice were inoc ulated i n with 10 L of 17Cl 1 cell lysates in DMEM The mice were monitored daily for health conditions At intervals of 2 5 8 11 and 30 days post infection dpi 5 mice from each dose of infection group and 3 mice from control group were sacrifi ced Lungs from infected and non infected control mice were rinsed in ice cold PBS Zhangsheng Yang et al www virosin org DECEMBER 2014 VOLUME 29 ISSUE 6 395 all tissues were separated into three portions for mea surements of virus loads by plaque assays or RT PCR and for histological analysis Hemmila E et al 2004 Viral loads by plaque assay and RT PCR To quantify the infectious virus particles in the lungs portions of the lungs removed at necropsy were weighed and homogenized in DMEM with 10 FBS and rapidly frozen and thawed for three times Cell debris were re moved by centrifugation and the virus titers PFU g tis sue in the supernatants were determined by plaque assay on 17Cl 1 cells as described previously Gombold J L et al 1993 Kim J C et al 1995 Lavi E et al 1984 MHV A59 N gene expression in the lung was analyzed by RT PCR Briefl y total RNA was extracted from 100 mg tissue with TRIzol reagent Invitrogen CA USA and 2 g RNA pretreated with 1 U of RQ1 RNase free DNase Fisher Scientifi c to remove DNA contamination at 37 C for 30min were used for reverse transcription with oligo dT primer Promega PCR reactions were then performed using the primers shown in Table 1 to de tect the MHV A59 N gene PCR products 123 bp were resolved by electrophoresis in 1 5 agarose gels and vi sualized a VersaDoc imaging system Bio Rad Histopathology evaluation Lung tissues were removed from the mice at indicat ed time points fixed in zinc formalin and processed as described previously McCray P B Jr et al 2007 For routine histology sections were stained with hematoxylin and eosin and the pathology of the lung was evaluated under microscope Olympus CH30 Japan by two in dependent technicians Department of Pathology China Agricultural University Beijing Cytokines profi les Total RNA were extracted by Trizol from tissues or MEF cells as described above and quantitative real time RT PCR reactions were performed using SYBR Green I Molecular Probes OR USA in a MyiQ system Bio Rad CA USA as described previously Doyle S et al 2002 Relative levels of each gene were normalized to that of 18s rRNA Primers for different genes were listed in Table 1 Data analysis and statistical comparisons All data were expressed as the mean standard devia tions of the mean SD The results were analyzed statis tically by using two way ANOVA Bonferroni post test for body weight changes and A Kruskal Wallis test was used to analyze the differences in numbers of relative cytokines expression levels Data with p 0 05 and p 0 01 were considered statistically signifi cant RESULTS Typical pneumonia was observed in MHV A59 infection mice To determine whether MHV A59 can induce lung injuries in mice we used sub lethal doses of the virus 1 5 10 5 or 1 5 10 4 PFU mouse to intranasally i n infect 4 week old C57BL 6 mice n 25 for each group A higher dose 5 10 6 PFU and above usually caused severe mortality thus not used in this study data not shown Mice infected by each dose began to show typical signs of illness at 3 days post infection dpi including difficulty in walking dormancy ruffled fur and hunched posture Infected groups lost appetite and reduced gain of body weights as compared to the control Table 1 Primers used for current study Description Forward 5 3 Reverse 5 3 MHV N gene CAGATCCTTGATGATGGCGTAGT AGAGTGTCCTATCCCGACTTTCTC L32 AAGCGAAACTGGCGGAAAC TAACCGATGTTGGGCATCAG 18s rRNA CCGCGGTTCTATTTTGTTGGT CTCTAGCGGCGCAATACGA IL 6 CACAGAGGATACCACATCCCAACA TCCACGATTTCCCAGAGAACA IP 10 CCAGTGAGAATGAGGGCCATA TCGTGGCAATGATCTCAACAC IFN AGCTCCAAGAAAGGACGAACAT GCCCTGTAGGTGAGGTTGATCT IFN 4 ATGGCTAGGCTCTGTGCTTCC CATTGCAGAATGAGTCTAGGAG TNF GGTGCCTATGTCTCAGCCTCTT CGATCACCCCGAAGTTCAGTA IL 1 CAACCAACAAGTGATATTCTCCATG GATCCACACTCTCCAGCTGCA IFN GCTCTGAGACAATGAACGCTAC TTCTTCCACATCTATGCCACTT IL 2 TGAGTGCCAATTCGATGATGAG AGGGCTTGTTGAGATGATGC IL 4 CATCCTGCTCTTCTTTCTCG CCTTCTCCTGTGACCTCGTT IL 5 GGGCCTTACTTCTCCGTGTA ACCTGAATAACATCCCAACCA IL 10 GGTTGCCAAGCCTTATCGGA ACCTGCTCCACTGCCTTGCT IL 12p40 GGAAGCACGGCAGCAGAATA AACTTGAGGGAGAAGTAGGAATGG MHV A59 induces acute lung injuries VIROLOGICA SINICA396 DECEMBER 2014 VOLUME 29 ISSUE 6 mice Figure 1A By 6 dpi most of mice 25 out of 30 mice showed apparently respiratory distress severe loss of appetite and emaciation The body weights of infected mice start to drop rapidly at 5 dpi 1 5 10 5 PFU group and 6 dpi for 1 5 10 4 PFU group respectively which continued to decrease until to 9 to 10 dpi Figure 1A One mouse in 1 5 10 5 PFU group was deceased at 10 dpi More importantly analysis of the gross pathological alteration in the lungs showed obvious pneumonia at 5 to Figure 1 Pathologic alterations in C57BL 6 mice by intranasal infection of MHV A59 A Change of body weights were monitored daily after mice n 5 per group were i n inoculated with different dose of MHV A59 or 17Cl 1 cell lysates n 3 of sham infected see methods as the control Two way ANOVA post hoc test p 0 05 B Representative of sever congestive hemarrhagic alterations in the lung black arrow and obvious necrotic foci in the liver blue arrow of 1 5 x 10 5 PFU group of mice panel a Control infection was shown in panel b C H Lavi E et al 1986 Besides injuries in the lung and liver the mice with intranasal infection of MHV A59 also showed brain tissue damage under microscopy data not shown and it is consistent with the previous report Lavi E et al 1986 Retention of gas in the intestines was also found in some of infected mice during necropsies 7 out of 20 mice No obvious lesions were observed in the heart or kidney Pro infl ammatory response to MHV A59 infection Histopathological changes would associate with inflammatory leukocyte infiltration in the lung Both MHV A59 inoculum groups exhibited significant lym phocyte infi ltration in alveolar walls Figure 1C panels a f a1 and b1 red arrows which included neutro phils macrophages and eosinophils among others Furthermore quantitative RT PCR analysis showed that type I inteferon response to MHV A59 infection in the lung was rather limited with transient induction of IFN only at 2 dpi and null response of IFN 4 within the course of study Figure 3C 3D These results suggested that acute coronavirus infection in the lung was associat ed with a suppressed anti viral type I interferon response in agreement with our previous results in vitro Wang G et al 2011 Zheng D et al 2008 These results further support the notion that coronaviruses may have evolved Figure 2 MHV A59 replicated in the lung and produced infectious viral particles A Plaque assay measurement of production of infectious virions in the lungs Log 10 PFU gram lung after mice were i n infected with MHV A59 n 5 or sham lysates n 3 for indicated time The number of mice positive for detectable PFU was plotted over total number of inoculated mice of positive PFU B Detection of MHV A59 replication at the indicated time post inoculation MHV A59 N gene in the lung homogenates n 5 for each time point post infection from A was detected by standard RT PCR amplifi cation L32 gene was used as a loading control MHV A59 induces acute lung injuries VIROLOGICA SINICA398 DECEMBER 2014 VOLUME 29 ISSUE 6 an effective strategy to evade anti viral innate immune response Chen J et al 2007 Reghunathan R et al 2005 Wang G et al 2011 Zheng D et al 2008 On the other hand intranasal infection of MHV A59 induced drastic up regulation of IP 10 Figure 3B and IFN Figure 3G in the lung especially in the early phase of infection suggesting involvement of macro phages and NK cells in the lung injury This result agreed with our previous fi nding of NK cells and IFN signal amplifi cation in hepatopathologenesis Kim K D et al 2007 The specific induction of IP 10 and suppression of IFN by MHV A59 were further confirmed in vi tro Sendai virus SeV infection of murine embryonic fibroblasts MEFs could effectively trigger both IP 10 and IFN expression Figure 4C and 4D In contrast MHV A59 could only stimulate IP 10 but not IFN ex pression Figure 4A and 4B The hyper response of IP 10 and IFN during MHV A59 infection was reminiscent of that in SARS CoV infection Huang K J et al 2005 Jiang Y et al 2005 Other inflammatory cytokines involved in tissue damage and repair such as TNF and IL 1 were also signifi cantly up regulated in the lung Figure 3E and F TNF is a critical cytokine for MHV A59 induced ful minant hepatitis as we have previously reported Kim K D et al 2007 IL 6 levels surged at 2 dpi and quickly came down to the basal level then after Fig 3A Typical Th1 IL 2 IL 5 and IL 12p40 or Th2 IL 4 and IL 10 cytokines had no signifi cant differences between the in fected and control mice Figure 3D 3H 3L suggesting that T cells activation would not play a major role in the lung injury The lung of neonatal mice lack of T cells was also susceptible to acute infection by MHV A59 with similar morbidity and mortality compared to adult mice data not shown support the notion that T cells may be dispensable to lung injury by coronavirus infec tion Therefore these results suggested that abnormal innate inflammatory activation and amplification in the lung would attribute to tissue injury and respiratory dis tress during acute coronaviruses infection DISCUSSION There still lacks suitable animal models to study pathogenesis of respiratory tract infection by SARS CoV and MERS CoV Devitt E 2013 This work is able to show that MHV A59 by intranasal inoculation can lead to lung infection and severe pneumonic manifestations in C57BL 6 mice The severity of MHV A59 infection correlated with virus replication in the lung and causative tissue damage Duration of lung infection reversibly cor relates with the dose of inoculum suggesting that a higher Figure 3 Proinfl ammatory cytokine response to MHV A59 in the lung Total RNA in the lung homogenates was extracted at indicated time post infection with 1 5 x 10 5 PFU MHV A59 n 5 or sham infection n 3 as control Real time RT PCR was preformed to measure indicated cytokine genes with18s rRNA gene as internal reference Kruskal Wallis test P 0 05 P 0 01 Zhangsheng Yang et al www virosin org DECEMBER 2014 VOLUME 29 ISSUE 6 399 dose of MHV A59 might stimulate more robust innate immunity to control the viral infection Recently studies revealed that mice intranasal in fection of MHV 1 resulted in acute pneumonia in the lung De Albuquerque N et al 2006 DeAlbuquerque N et al 2006 Leibowitz J L et al 2010 Ma X Z et al 2010 which were consistent with our observations by MHV A59 infection Although multiple strains of mice were applied for testing of MHV 1 infection only A J De Albuquerque N et al 2006 Leibowitz J L et al 2010 Ma X Z et al 2010 followed by C3H HeJ mice De Albuquerque N et al 2006 were shown of higher sus ceptible to the lung disease of pneumonia However the immunological responses maybe altered in these mice with infection of coronavirus due to the immunological components deficient Since multiple factors including IL 3 Naip5 Naip5 NLR family apoptosis inhibitory protein 5 and complement factor C5 were defi cient in A J mice JAX mice database while C3H HeJ mice was known for defi ciency of TLR4 JAX mice database Aberrant elevation of innate inflammatory response plays a critical role in lung injury and respiratory dis tress In this sense IP 10 may help chemoattracting NK cells Biddison W E et al 1998 Farrar M A et al 1993 Loetscher M et al 1996 to lesions as sug