【病毒外文文献】2009 Detection of severe acute respiratory syndrome (SARS) coronavirus nucleocapsid protein in human serum using a local

Biosensors and Bioelectronics 25 2009 320 325 Contents lists available at ScienceDirect Biosensors and Bioelectronics journal homepage Detection of severe acute respiratory syndr protein in human serum using a localized fiber optic biosensor Jason C Huang a c e 1 Ying Feng Chang b 1 Kuan Hsuan Chii Chang Chen d Yi Ming Arthur Chen c f Chien Chou a Univ b c an d e f Taiwan g Taiw article Article R Received in revised form 8 July 2009 Accepted 10 July 2009 Available online 17 July 2009 Keywords F Gold Localize N Se nucleocapsid coupled fluorescence LSPCF fiber optic biosensor that combines sandwich immunoassay with the LSP technique Experimentally a linear relationship between the fluorescence signal and the concentration of recombinant SARS CoV N GST N protein in buffer solution could be observed from 0 1 pg mL to 1 ng mL In addition the concentration of GST N protein in diluted serum across a similar range could also be measured The correlation coefficients linear scale for these two measurements were 0 9469 and 1 disease e whic tion s futur outbr Ming Chang f C 0956 56 doi iber optic biosensor nanoparticle d surface plasmon ucleocapsid protein vere acute respiratory syndrome SARS 0 9624 respectively In comparison with conventional enzyme linked immunosorbent assay ELISA the detection limit of the LSPCF fiber optic biosensor for the GST N protein was improved at least 10 4 fold using the same monoclonal antibodies Therefore the LSPCF fiber optic biosensor shows an ability to detect very low concentration 1 pg mL of SARS CoV N protein in serum The biosensor should help with the early diagnosis of SARS infection 2009 Elsevier B V All rights reserved Introduction Severe acute respiratory syndrome SARS is a highly infectious that results in death in a great portion of patients Drosten t al 2004 SARS is caused by the SARS coronavirus SARS CoV h is detectable in respiratory secretions of patients after infec Fouchier et al 2003 This disease is highly contagious and till has the potential to cause a very large scale epidemic in the e in the absence of a vaccine or effective therapeutic drugs Wang et al 2004 The key to preventing and controlling a future eak of SARS is to block transmissions of infection through a Corresponding author at AIDS Prevention and Research Center National Yang University Taipei 112 Taiwan Tel 886 2 28267193 fax 886 2 28270576 Corresponding author at Graduate Institute of Electro Optical Engineering Gung University Taoyuan 333 Taiwan Tel 886 3 2118800 x3677 ax 886 3 2118507 E mail addresses arthur ym edu tw Y M A Chen cchou mail cgu edu tw Chou 1 Equal contribution in this research strict quarantine policy Therefore a rapid sensitive specific and accurate diagnostic method is essential so that suspected patients can be correctly assessed Jiang et al 2004 Che et al 2004 Cur rently there are several diagnostic methods used for the detection of SARS The first option is based on nucleic acid detection Since the genome of SARS CoV has been sequenced completely Marra et al 2003 Rota et al 2003 reverse transcription polymerase chain reaction RT PCR is the most common method that is used to detect the SARS CoV during the early phase immediately after the onset of clinical symptoms Hourfar et al 2004 Louie et al 2006 Petrich et al 2006 However the RT PCR assay is probably not sensitive enough to detect SARS CoV in secretions or serum until 3 days after the onset of symptoms Yam et al 2003 Statistically about half of SARS patients cannot be identified at an early stage based on viral RNA detection Li et al 2005 Besides the RT PCR tests require not only a thermal cycler for conventional PCR or a more complicated machine for real time PCR Liu et al 2005 but also a specific lab oratory with expertise in molecular diagnostics to confirm SARS in the acute phase Drosten et al 2004 Che et al 2004 Fujimoto et al 2008 Unfortunately other sequence based methods such 63 see front matter 2009 Elsevier B V All rights reserved 10 1016 j bios 2009 07 012 Department of Biotechnology and Laboratory Science in Medicine National Yang Ming Institute of Biophotonics National Yang Ming University Taipei 112 Taiwan AIDS Prevention and Research Center National Yang Ming University Taipei 112 Taiw Department of Optics and Photonics National Central University Taoyuan 320 Taiwan Department of Education and Research Taipei City Hospital Taipei 112 Taiwan Institute of Microbiology and Immunology National Yang Ming University Taipei 112 Graduate Institute of Electro Optical Engineering Chang Gung University Taoyuan 333 info history eceived 1 June 2009 abstract In order to enhance the sensiti coronavirus SARS CoV ome SARS coronavirus nucleocapsid surface plasmon coupled fluorescence Chen c f 1 Li Chen Su d Chun Wei Lee a f b d g ersity Taipei 112 Taiwan an vity of conventional immunoassay technology for the detection of SARS protein N protein we developed a localized surface plasmon J C Huang et al Biosensors and Bioelectronics 25 2009 320 325 321 as a real time loop mediated amplification assay Poon et al 2004 2005 Hong et al 2004 a gold film with enzymatic electrochemical genosensor Abad Valle et al 2005 and a rolling circle amplifica tion PCR based assay Wang et al 2005 exhibit lower sensitivity than the RT PCR method Serological testing is another diagnos tic option However serological tests have shown a relatively low sensitivity of only 65 4 using sera obtained 6 10 days after the onset of symptoms Shi et al 2004 The third option is based on de 20 patients so al CoV e N and it da N ease diagnos adv nat the enzyme link use Y an fr pr link the the biosensing incr e pr in e electr Duyne mon immunoassa b tall demons immunoglobulin e fib serum L sensiti 0 ear 2 2 serum eter 20 nm phosphate buffer saline PBS tablet ethyl acetate and 2 propanol were purchased from Sigma Inc St Louis MO USA The fluorescent labeling kit DyLight TM 649 was purchased from Pierce Co Rockford IL USA The plastic optical fiber was purchased from Mitsubishi Rayon Co LTD Tokyo Japan 2 2 Plasmid construction tecting antibodies against SARS CoV after infection Peiris et al 03a However the antibody response in more than 93 of SARS takes at least 10 28 days to develop after symptoms onset this approach is not a good method for early detection Peiris et 2003b The final possible approach is to detect specific SARS antigens such as the spike protein Zhao et al 2005 Haynes t al 2007 Manopo et al 2005 and particularly the nucleocapsid protein The N protein is one of the early expressed proteins should have diagnostic value In the serum of SARS patients has been shown that N protein can be detected as early as 1 y after infection Che et al 2004 Thus detection of SARS CoV proteins is a valuable approach to diagnose and monitor dis activity and makes it possible to develop a rapid and accurate tic method at an early stage In addition one significant antage of detecting SARS CoV N protein in serum is to elimi e the risk of infection while collecting nasopharyngeal aspirates Che et al 2004 Among several possible methods are available for detection of SARS CoV N protein conventional antigen capture ed immunosorbent assay ELISA is the most widely d method Chen et al 2005 Chan et al 2005 Qiu et al 2005 et another method of detecting SARS CoV N protein is based on immunofluorescence assay which was able to detect SARS CoV om SARS patients as early as 2 days after the onset of symptoms Liu et al 2005 Recently Professor Okamoto and his co workers oposed a highly sensitive immunoassay based on an enzyme ed immunosorbent assay using chemiluminescence CLEIA for detection of SARS CoV N protein and this method has pushed detection limit to 1 56 pg mL Fujimoto et al 2008 Recently gold nanoparticles GNPs have been introduced into and proved to be one of the most efficient ways to ease the detection limit of biosensors Manso et al 2008 Cui t al 2008 It is well known that GNPs possess special optical operties such as localized surface plasmons LSPs which result wavelength selective absorption with extremely large molar xtinction coefficients and significant enhancement of the localized omagnetic field close to the GNP surface within 50 60 nm Mock et al 2003 Sonnichsen et al 2002 McFarland and Van 2003 Based on the property of localized surface plas coupled fluorescence LSPCF combined with the sandwich y a novel fiber optic biosensor has been proposed y our group to study protein protein interactions Experimen y the detection limit of LSPCF fiber optic biosensor has been trated to be as low as 1 pg mL when detecting mouse G IgG interacting with anti mouse IgG Hsieh t al 2007 In addition we have also demonstrated that the LSPCF er optic biosensor is able to measure alpha fetoprotein in human as low as 0 1 ng mL Chang et al 2009 In this report the SPCF fiber optic biosensor is applied to enhance the detection vity of SARS CoV N protein in diluted serum to a limit of 1 pg mL Clearly the biosensor has significant potential for the ly detection of clinical SARS CoV infection Materials and methods 1 Materials Human serum was prepared from a healthy donor Bovine albumin BSA GNP conjugate protein A Au PA GNP diam The RNA genome sequence of SARS CoV was utilized as a template to synthesize the cDNA sequence with the proper codon usage for E coli The cDNA sequence encoding the N protein was synthesized by RT PCR reaction using the specific primers F5 prime GCCGAATTCATGTCTGATAA TGGACCCCA 3 prime and R5 prime GCGCGTCGACGTTATGCCTGAGTTGAATCA 3 prime The cDNA fragment 1 3 kD of N protein so obtained was digested with EcoRI and SalI restriction enzymes and then ligated into the vector pGEX 5X 1 which contains a glutathione S transferase GST tag sequence The expression vector encoding recombinant SARS CoV N protein was named GST N protein 2 3 Expression and purification of recombinant SARS CoV N protein The GST N plasmid was transformed into E coli BL21 for expres sion of recombinant SARS CoV N protein After 3 h of induction with isopropyl H9252 d thiogalactopyranoside IPTG 1 mM the bac teria were harvested and pellet resuspended in NETN buffer 20 mM Tris base in pH 8 0 100 mM NaCl 1 mM EDTA and 0 5 NP 40 for protein purification The protein mixture was next incubated with glutathione agarose beads Sulphur linkage Sigma St Louis MO USA for 12 h After the elution the GST tagged N protein was concentrated for immunization 2 4 Preparation of anti SARS CoV N protein antibodies Six week old BALB c mice were immunized and twice boosted with 25H9262g of GST N protein in 0 1 mL of PBS emulsified with an equal volume mixture of complete incomplete Freund s adju vant Sigma St Louis MO USA After the antibody titers against GST N protein had been confirmed by ELISA and immunoblotting splenocytes were harvested and fused with NS 1 myeloma cells The hybridoma culture supernatants were then screened by ELISA and immunoblotting against the GST N protein Single clones pro ducing a specific antibody were selected by the limiting dilution method Polyclonal antibodies against GST N protein were also prepared using New Zealand white rabbits which were immu nized and boosted with 100H9262g of GST N proteins in 0 5 mL PBS emulsified with an equal volume mixture of complete incomplete Freund s adjuvant twice or three times After the antibody titers against GST N fusion protein were confirmed then blood was taken from the rabbits for further purification The monoclonal and poly clonal antibodies were purified from mouse ascites and rabbit serum respectively using protein A affinity columns GE Health care Buckinghamshire UK Two monoclonal antibodies against GST N protein used in this study and were named anti N 1 antibody and anti N 2 antibody 2 5 Immunoblotting analysis In total 1 0H9262g of purified GST N protein was loaded into each well of a 10 sodium dodecyl sulfate SDS polyacrylamide gel for electrophoresis After the transfer of the separated proteins to polyvinylidene difluoride membrane PVDF Millipore Billerica MA USA the blot was cut into strips and incubated separately with 2 5H9262g mL of anti N 1 antibody or 5H9262g mL of anti N 2 antibody 322 J C Huang et al Biosensors and Bioelectronics 25 2009 320 325 The blots were then washed and incubated with peroxidase conjugated anti mouse secondary antibody Finally the proteins on the strips were visualized using the Western Lightning Plus chemi luminescence reagent PerkinElmer and X ray film exposure 2 6 Conventional ELISA for GST N protein detection Immunoplates PerkinElmer Shelton CT USA were first coated with bodies bloc Tw 1 bat 10 adde conjug 37 solution t absorbance Winooski w w 2 7 cal PMMA Subseq pr carrie the t e firs cap tr 4 93 Y for fold and body tar fib the 2 8 lab ondar lab pr anti N 2 9 2 9 C objecti coupling length the surface during measurement A narrow band pass filter central wavelength 680 4 nm bandwidth 11 1 nm was introduced into this setup to allow fluorescence detection via a photomultiplier tube PMT R3896 Hamamatsu Shizuoka Japan Experimentally a lock in amplifier SR830 Stanford Research Systems Sunny vale CA was used in order to increase the signal to noise ratio SNR From the specifications of R3896 and SR830 the detection sensitivity of smallest detectable fluorescence signal is equal to 4 21 10 5 luminance 3 Results In order to generate monoclonal and polyclonal antibodies against SARS CoV N protein we created a recombinant N protein fused with GST that was expressed in Escherichia coli The recom binant GST N protein of 72 kD was detected by SDS PAGE and is shown in supplemental information feature 2A Hybridoma cells were prepared from mice immunized with GST N protein and mon oclonal antibodies were purified from culture supernatant of these hybridoma cells The reactivity of the two monoclonal antibod ies anti N 1 and anti N 2 against the GST N protein used in this study is presented in supplemental information feature 2B The next step was to establish an antigen capture system for SARS CoV that would allow the concentration of GST N protein to be determined by ELISA Since the monoclonal antibodies were both derived from mouse it is not possible to use them as the capture and detection 100H9262L of 4 0H9262g mL anti N 1 and anti N 2 monoclonal anti the capture antibody at room temperature overnight After king with 5 nonfat milk in PBST PBS buffer containing 0 05 een 20 for 1 h 100H9262L of serially diluted GST N proteins in PBS or 0 fold diluted human serum were added into each well and incu ed at 37 C for 2 h The plates were then washed five times and 0 H9262L of anti GST N protein polyclonal antibody 5H9262g mL was d with 2 h incubation at 37 C Correctly diluted peroxidase ated anti rabbit antibody was then added and incubated at C for 1 h after washing Finally 75H9262L of TMB TBABH substrate per well was added and color developed for 10 min before ermination with 125H9262LofH 2 SO 4 stop solution 1 M The optical at 450 nm was measured by ELISA reader Bio Tek Inc VT USA A blank control in the absence of GST N protein as included for normalization of the absorbance Each dilution as performed in duplicate Preparation of optic fiber and setup of biosensor A plastic polymethyl methacrylate PMMA multimode opti fiber of 1 mm in diameter was used in this experiment The fiber was de clad by immersing the fiber in ethyl acetate uently the declad portion of fiber was washed with 2 opanol to clean the declad surface Chemical adsorption was d out using covalent binding forces in order to immobilize capture antibody onto the surface of declad portion The pro ocol of chemical adsorption has been described previously Chang t al 2009 The modified declad portion of each optical fiber was t coated with 1 mL of 1H9262g mL anti N 1 monoclonal antibody ture antibody at 4 C overnight The calculated surface concen ation of immobilized capture antibody on PMMA fiber surface is 5 ng mm 2 NUL 5 758 ng mm 2 approximately Jung et al 1998 u et al 2004 After blocking with 10 mg mL BSA PBS solution 1 h 1 mL of serially diluted GST N proteins in PBS and in 10 diluted human serum were added into each reaction chamber incubated at 4 C for 2 h in order to form the capture anti get antigen complex on the modified declad portion of er surface as shown in supplemental information Figure 1 Then fibers were washed five times Preparation of the fluorescence probe The fluorescence probe is composed of fluorophores which are eled with secondary antibodies connecting to Au PA The sec y antibody is anti N 2 monoclonal antibody fluorescently eled with DyLight TM 649 utilizing a commercial labeling kit To oduce the fluorescence probe 100 ng mL of fluorophore labeled antibody was mixed with Au PA at a concentration of 10 9 particles mL and incubated for 1 day at 4 C in the dark Measurement A 658 nm diode laser Micro Laser System Garden Grove A was used as the excitation light source and a microscope ve 20 NA 0 45 was used in order to achieve the best efficiency The fluorophore of which the central wave of the emission spectrum was 674 nm was excited by enhanced localized electromagnetic field close to the GNP Fig 1 Detection of GST N protein by conventional sandwich ELISA A Serially diluted GST N proteins in PBS were detected by sandwich ELISA Different concen trations of GST N protein were assayed on a microtiter plate coated with anti N 1 and anti N 2 monoclonal antibodies The absorbance of OD450 in each well was observed after further incubation with polyclonal anti GST N antibody followed by peroxidase conjugated anti rabbit antibody B GST N protein was serially diluted in 10 fold diluted human serum and assayed by ELISA Results shown are the mean of duplicates Error bars indicate the standard deviation J C Huang et al Biosensors and Bioelectronics 25 2009 320 325 323 antibodies because the secondary anti mouse IgG will bind to both murine antibodies Therefore we immobilized both anti N 1 and anti N 2 antibodies on ELISA plates as the capture antibodies for the GST N protein and used rabbit polyclonal anti GST N antibodies as the detection antibody Various concentration of GST N protein was diluted in PBS 6400 0 2 ng mL and the ELISA results are shown in Fig 1A In this sandwich ELISA GST N protein was successfully detected at concentrations as low as 12 5 25 ng mL In order to examine whether serum proteins might interfere with the antigen capture of SARS CoV N protein another ELISA was carried with var ious concentration of GST N protein diluted using 10 fold diluted human serum As shown in Fig 1B in this circumstance the GST N protein can be detected down to the range of 0 78 1 56 ng mL The temporal fluorescence intensity of biomolecular interaction between the LSPCF probe and GST N protein in PBS at different con centrations is shown in Fig 2A The concentrations of GST N protein at 0 pg mL 0 1 pg mL 1 pg mL 10 pg mL 100 pg mL and 1 ng mL were tested separately When a fixed concentration of LSPCF probes was injected into the reaction chamber a great number of LSPCF probes migrated into the interaction region of the evanescent field near fiber core surface Consequently a rapid increase in fluores cence intensity at the beginning of the assay is observed However not all LSPCF probes in the interaction region bind to GST N proteins F fib with triangledownsld measur r in and target antigens which are captured by the immobilized anti N 1 antibodies capture antibodies on the fiber core surface In these circumstances the LSPCF probes that are not associated with the antigens diffuse out of the interaction region of the evanescent field such that the fluorescence intensity decreases sharply In addi tion when LSPCF probes are injected into the reaction chamber this induces the disturbance that results in decreasing of fluorescence signal in the measurement Finally the signal reaches equilibrium as shown in Fig 2A The SNR in this experiment was better than 9 at different concentrations of GST N prot