【病毒外文文献】2005 Evaluation of Inapparent Nosocomial Severe Acute Respiratory Syndrome Coronavirus Infection in Vietnam by Use of Hi

CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY July 2005 p 848 854 Vol 12 No 7 1071 412X 05 08 00H110010 doi 10 1128 CDLI 12 7 848 854 2005 Copyright 2005 American Society for Microbiology All Rights Reserved Evaluation of Inapparent Nosocomial Severe Acute Respiratory Syndrome Coronavirus Infection in Vietnam by Use of Highly Specific Recombinant Truncated Nucleocapsid Protein Based Enzyme Linked Immunosorbent Assay Fuxun Yu 1 Mai Quynh Le 2 Shingo Inoue 1 Hong Thi Cam Thai 1 Futoshi Hasebe 1 Maria del Carmen Parquet 1 and Kouichi Morita 1 Department of Virology Institute of Tropical Medicine Nagasaki University 1 12 4 Sakamoto Nagasaki 852 8523 Japan 1 and Department of Virology National Institute of Hygiene and Epidemiology NIHE Hanoi Vietnam 2 Received 24 January 2005 Returned for modification 6 April 2005 Accepted 18 April 2005 Severe acute respiratory syndrome SARS is a recently emerged human disease associated with pneumonia Inapparent infection with SARS coronavirus CoV is not well characterized To develop a safe simple and reliable screening method for SARS diagnosis and epidemiological study two recombinant SARS CoV nucleo capsid proteins NH11541 protein and NH9004 121 protein were expressed in Escherichia coli purified by affinity chro matography and used as antigens for indirect immunoglobulin G enzyme linked immunosorbent assays ELISA Serum samples collected from healthy volunteers and SARS patients in Vietnam were used to evaluate the newly developed methods The NH11541 protein based ELISA showed a highly nonspecific reaction The NH9004 121 protein based ELISA with a nonspecific reaction drastically reduced compared to that of the nearly whole length NH11541 protein based ELISA resulted in higher rates of positive reactions higher titers and earlier detection than the SARS CoV infected cell lysate based ELISA These results indicate that our newly developed SARS CoV NH9004 121 protein based ELISA is not only safe but also a more specific and more sensitive method to diagnose SARS CoV infection and hence a useful tool for large scale epidemiological studies To identify inapparent SARS CoV infections serum samples collected from health care workers HCWs in Vietnam were screened by the NH9004 121 protein based ELISA and positive samples were confirmed by a virus neutralization test Four out of 149 HCWs were identified to have inapparent SARS CoV infection in Vietnam indicating that subclinical SARS CoV infection in Vietnam is rare but does exist Severe acute respiratory syndrome SARS is a recently emerged human disease associated with pneumonia The first outbreak was recognized in late February 2003 in Hanoi Viet nam and was believed to have originated in November 2002 in the Guangdong province of China with several hundred cases of severe atypical pneumonia 2 8 18 26 Following the detection of similar cases in Hong Kong and Canada the World Health Organization WHO issued a global alert for the illness and later designated it SARS 12 17 22 The disease has since affected 30 countries on five continents with more than 8 400 cases and more than 900 deaths The identi fication of the virus and subsequent unraveling of the SARS coronavirus CoV genome sequence are important from a public health perspective The SARS CoV genome is about 29 kb in size and comprises 11 open reading frames It contains a well conserved region encoding an RNA dependent RNA polymerase with two open reading frames a variable region encoding four viral structural proteins spike S protein en velope E protein membrane M protein and nucleocapsid N protein and five putative genes encoding uncharacterized proteins 15 18 Its gene order is similar to that of the other known coronaviruses however phylogenetic analyses and se quence comparisons indicate that this virus does not closely resemble any of the previously characterized coronaviruses The epidemiology of SARS remains poorly understood It is still unclear whether SARS CoV asymptomatic infection ex ists Such information is important not only to understand the virulence of the virus and its pathogenesis but also to identify potential implications for the transmission and control of SARS The existing reports about nonpneumonic and subclin ical SARS coronavirus infections are conflicting On one hand Chan et al and Chow et al reported that no subclinical infec tion was found among health care workers HCWs 3 4 On the other hand Woo and colleagues suggested in their report that nonpneumonic SARS CoV infections are more common than SARS pneumonia 24 Therefore to clarify this more extensive seroprevalence studies are needed Currently the most widely used serologic assays for SARS are indirect immunofluorescence assays using SARS CoV in fected cells and enzyme linked immunosorbent assays ELISA using cell culture extracts as antigens In addition to causing antigenic cross reactivity between SARS CoV infected Vero cells and group I coronaviruses these methods are dif ficult and often cumbersome 10 Moreover SARS CoV in fected cells and cell culture extracts present a considerable risk of infection among laboratory workers The frequent incidence Corresponding author Mailing address Department of Virology Institute of Tropical Medicine Nagasaki University 1 12 4 Sakamoto Nagasaki 852 8523 Japan Phone 81 95 849 7829 Fax 81 95 849 7830 E mail moritak net nagasaki u ac jp 848 of SARS infections among laboratory researchers in Singa pore Taiwan and Beijing China has caused great concern about laboratory safety 14 27 28 Hence safer and more convenient methods for SARS diagnosis and large scale epi demiological studies are needed The SARS outbreak in Vietnam began with the admission of a traveler from Hong Kong to the French Hospital a 56 bed three story privately owned expatriate operated hospital lo cated in Hanoi Vietnam on 26 February 2003 Within 2 weeks extensive nosocomial transmission of SARS occurred mainly among the hospital staff On 12 March this hospital was closed to new admissions with the exception of hospital work ers On 28 April 2003 Vietnam became the first country to recognize and contain a SARS outbreak as announced by the WHO In Vietnam SARS occurred mainly in the above men tioned French Hospital among HCWs and the existence of a clear index case transmitting the virus to close contacts was identified All of these characteristics made this place ideal to study the epidemiology of this disease To undertake the study of SARS CoV subclinical infection among Vietnamese HCWs we developed a truncated SARS CoV N protein based ELISA system by using recombinant techniques This new ELISA system is safer more specific and more sensitive for the diagnosis of SARS CoV infection The present study describes the existence of asymptomatic SARS CoV infection in Vietnam as proven by use of this new screening method and confirmed by a virus neutralization test Data on the sensitivity and specificity of this SARS CoV ELISA system based on recombinant truncated N proteins are discussed MATERIALS AND METHODS Serum samples One hundred seventy five serum samples from healthy vol unteers from Hanoi collected before the SARS outbreak were used as negative controls Serum samples from 149 HCWs who were in close contact with SARS patients at the French Hospital in Hanoi were included in this study Among them 37 were probable SARS cases per the WHO case definition and 112 were symptom free Serial serum samples from those 37 probable SARS cases and 112 symptom free HCWs were collected from 11 March to 3 April 2003 RNA extraction SARS CoV strain Hanoi 01 03 isolated from a Vietnamese patient was propagated in a Vero E6 cell line maintained at 37 C in Eagle s minimum essential medium supplemented with 2 fetal calf serum and 0 2 mM of each nonessential amino acid for 4 days Upon observation of 80 to 100 cytopathic effect CPE the infected culture supernatant was clarified by light centrifugation at 2 000 H11003 g for 10 min Viral RNA was extracted from 140 H9262lof infected culture supernatant by using the QIAamp viral RNA minikit QIAGEN Hilden Germany according to the manufacturer s instructions The extracted RNA was eluted in 60 H9262l of elution buffer and then used as the template for reverse transcription RT PCR Construction of recombinant plasmids The gene for the SARS CoV N pro tein was amplified by RT PCR as previously described 9 PCR amplification was carried out using primers 5H11032 TAATGGATCCCAATCAAACCAA 3H11032 and 5H11032 TGTGGTCGACATGAGTGTTTAT 3H11032 to generate a gene for the NH11032 protein the N protein with the four leading amino acids aa clipped and primers 5H11032 AGAAGGATCCCTTCCCTACGGCGCT 3H11032 and 5H11032 TGTGGTCGACATGAG TGTTTAT 3H11032 to generate a gene for the NH9004 121 protein a second N protein construct with 121 aa of the N terminus truncated The sense and reverse primers contained BamHI and SalI restriction sites underlined respectively The 1 3 kb and 0 9 kb PCR amplified DNA fragments were digested with BamHI and SalI and subsequently cloned into the corresponding restriction site of the pQE30 vector QIAGEN Hilden Germany Two expression products one encompassing aa 5 to 422 and another encompassing aa 122 to 422 of the SARS CoV N protein were obtained and both constructs contained a vector derived His tag histidine hexamer at their N termini The resultant recombi nant proteins were designated SARS NH11032 and SARS NH9004 121 respectively Expression and purification of the recombinant SARS CoV N proteins The recombinant SARS CoV N proteins were expressed by inserting the recombi nant plasmids containing the SARS CoV NH11032 and SARS CoV NH9004 121 sequences into Escherichia coli strain XL1 Blue and then cultured at 30 C in Luria Bertani medium containing 100 H9262g ml of ampicillin When the optical density at 600 nm OD 600 of the culture reached 0 5 expression of the recombinant proteins was induced by the addition of 0 2 mM isopropyl H9252 D thiogalactopyranoside IPTG for 3 h The cells were harvested by centrifugation washed in phosphate buffered saline PBS solution resuspended in 10 mM PBS pH 7 5 500 mM NaCl and frozen at H1100280 C After being frozen and thawed three times the cell suspension was sonicated for 2 min with an interval of 1 s between pulses and centrifuged at 30 000 H11003g for 15 min at 4 C The supernatant was then applied to a Talon IMAC resin column Clontech After being washed with 10 mM PBS 500 mM NaCl containing 20 mM imidazole the purified proteins were then eluted with 10 mM PBS pH 7 5 500 mM NaCl containing 250 mM imidazole The protein solutions were aliquoted and stored in a final concentration of 10 glycerol at H1100280 C until use Protein concentrations were determined by the Bradford method 1a with a protein assay reagent kit Bio Rad and the purity of the proteins was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS PAGE Western blot analysis Western blotting was performed as described by Tow bin et al 21 Briefly proteins separated in a 10 polyacrylamide gel were transferred to a polyvinylidene difluoride PVDF membrane Immobilon Mil lipore by using a semidry electroblotter Sartorius Germany The membrane was initially blocked with Blockace Yukijirushi Sapporo Japan overnight at 4 C subjected to reaction with mouse antihistidine serum 1 200 dilution Am ersham Biosciences NJ SARS CoV immunized rabbit serum 1 200 dilution supplied by the National Institute of Infectious Disease Japan or SARS patient serum 1 100 dilution for1hat37 C and then incubated with rabbit anti mouse immunoglobulin G IgG peroxidase conjugate or goat anti rabbit IgG peroxi dase conjugate or goat anti human IgG peroxidase conjugate 1 1 000 dilution all conjugates were procured from American Qualex California for 1 h at 37 C Finally the reaction results were visualized by dimethylamino benzidine DAB staining ELISA using the recombinant nucleocapsid proteins A total of 175 serum samples collected from healthy volunteers in Vietnam before the SARS outbreak and 150 serial serum samples collected from 37 patients with pneumonia were used for the assessment of the IgG antibody ELISA The optimal concentrations of recombinant NH11032 and NH9004 121 proteins were determined by checkerboard titra tion with different dilutions of coating recombinant proteins The optimal amount of antigen for plate coating was 0 13 H9262g per ELISA well for each recombinant protein Ninety six well Nunc immunoplates Roskilde Denmark were coated with recombinant NH11032 or NH9004 121 protein antigens in carbonate buffer pH 9 6 overnight at 4 C and then blocked with Blockace for1hatroom temperature After the immunoplates were washed six times with PBS Tween 20 100 H9262l of 1 100 human serum diluted in Blockace was added to each well and incubated for 1 h at 37 C Then after the plates were washed six times with PBS Tween 20 100 H9262l of 1 30 000 diluted horseradish peroxidase conjugated goat anti human IgG American Qualex California was added to each well and the plates were incubated at 37 C for 1 h After six more washes with PBS Tween 20 100 H9262l of diluted o phenylenediamine was added to each well and incubated in the dark at room temperature for 10 min The reaction was then stopped by adding 100 H9262lof1NH 2 SO 4 to each well The OD 492 for each well was measured with a 620 nm reference filter Each sample was tested in duplicate and the mean OD for each sample was calculated ELISA titers were calculated from standardized reciprocal dilution values by using Thermo Labsystem s Ascent photospectrometric data analysis software version 2 6 Each serum sample was checked twice and the mean antibody titers were recorded ELISA using SARS CoV infected cell lysates An ELISA using SARS CoV infected Vero E6 cell lysates was performed according to the protocol of the Centers for Disease Control and Prevention Atlanta Georgia 10 The cell lysates of the SARS CoV infected and uninfected Vero E6 cells were supplied by the Centers for Disease Control and Prevention Virus neutralization test A virus neutralization test was done under biosafety level 3 conditions by using the 50 tissue culture infective dose method Briefly sera were heat inactivated at 56 C for 30 min and then serially diluted twofold from 1 10 to 1 1 280 An equal volume of virus infected cell culture fluid with a titer of 200 50 tissue culture infective doses was added to 200 H9262l of each serum dilution and incubated for1hat37 C Each dilution was then added to triplicate wells on a 96 well culture plate with Vero E6 cells previously grown to conflu ence After 5 days the existence of CPE was determined and quantified Neu tralization titers were expressed as the reciprocal values of the highest dilution of serum for which a 50 reduction of CPE was observed VOL 12 2005 EVALUATION OF INAPPARENT NOSOCOMIAL SARS CoV INFECTION 849 RESULTS Expression and purification of recombinant SARS CoV N proteins The recombinant SARS CoV N proteins encom passing amino acid residues 5 to 422 and 122 to 422 of the nucleocapsid protein were amplified by RT PCR and cloned into the BamHI and SalI sites of the expression vector pQE30 in frame and downstream of the six histidine tag The recom binant proteins were successfully expressed in E coli and pu rified by use of a Talon metal affinity column under natural conditions Analysis of purified recombinant proteins by SDS PAGE and Coomassie blue staining revealed as predicted single protein bands of 46 kDa and 32 kDa for the two recom binant SARS CoV NH11032 and NH9004 121 proteins respectively Fig 1 The identities of the recombinant SARS CoV NH11032 and NH9004 121 proteins were further confirmed by Western blot assay with mouse antihistidine serum SARS CoV immunized rabbit se rum and SARS patient serum Fig 2 Calibration of ELISA for recombinant NH11541 and NH9004 121 pro teins In order to determine the basal titers and cutoff values serum samples collected from 175 healthy volunteers in Viet nam before the SARS outbreak were used for the assessment of the indirect IgG ELISA for recombinant SARS CoV NH11032 and SARS CoV NH9004 121 proteins When the NH11032 protein was used as the coating antigen 38 out of the 175 serum samples showed titers higher than 100 ranging from 100 to 3 200 On the contrary when the SARS CoV NH9004 121 protein was used only 11 out of 175 samples showed titers between 100 and 260 Further analysis of all of these positive samples by Western blotting also confirmed the reactivities data not shown indi cating that the positive reaction by ELISA was not due to the potential interaction between residual E coli antigens and naturally occurring antibodies against E coli in human sera We chose seven serum samples which showed high titers by the NH11032 protein based ELISA but were negative by the NH9004 121 pro tein based ELISA and confirmed their reactivities by Western blot assay As shown in Fig 3 these seven samples were pos itive by the NH11032 protein based Western blot assay but negative by the NH9004 121 protein based Western blot assay This indicates FIG 1 Recombinant plasmids containing the NH11032 and NH9004 121 genes were transformed into E coli strain XL1 Blue and induced with IPTG E coli cell lysates were analyzed in a 10 SDS PAGE gel and revealed with Coomassie brilliant blue staining Lane M protein marker SDS 7B Sigma St Louis Mo lanes 1 and 4 supernatant of sonicated E coli cell lysate after centrifugation lanes 2 and 5 pellet of sonicated E coli cell lysate lanes 3 and 6 purified recombinant protein FIG 2 Western blot analysis of purified NH11032 and NH9004 121 proteins The prestained protein marker and purified recombinant proteins were separated by SDS PAGE and transferred to a PVDF membrane Each membrane was incubated with diluted serum followed by horse radish peroxidase conjugated anti rabbit IgG anti mouse IgG or anti human IgG 1 1 000 dilution and detected by DAB staining A Re activity of recombinant proteins to rabbit anti SARS CoV serum B Reactivity of recombinant proteins to mouse antihistidine serum C Reactivity of recombinant proteins to SARS patient serum Lanes M protein marker SDS 7B lanes 1 purified SARS NH11032 protein lanes 2 purified SARS NH9004 121 protein FIG 3 Western blot analysis of sera that reacted with the NH11032 pro tein but not with the NH9004 121 protein Purified recombinant NH11032 and NH9004 121 proteins were separated by SDS PAGE and transferred to a PVDF membrane separately The membranes were cut into strips and incubated with diluted serum 1 100 dilution from seven healthy vol unteers I II III IV V VI and VII followed by horseradish per oxidase conjugated anti human IgG 1 1 000 dilution and detected by DAB staining These sera showed high titers of antibodies to the NH11032 protein by the NH11032 protein based ELISA but were negative by the NH9004 121 protein based ELISA P SARS patient serum used as a positive con trol The odd numbered lanes represent reactions with the NH11032 protein and the even numbered lanes represent reactions with the NH9004 121 pro tein 850 YU ET AL CLIN DIAGN LAB IMMUNOL that the cross reactivity observed for these healthy volunteer donors was caused by the N terminus of the SARS CoV N protein which has conserved motifs with other coronaviruses 18 Evaluation of recombinant NH9004 121 protein based ELISA Se rial serum samples collected from 37 probable SARS cases were assessed by the recombinant NH9004 121 protein based ELISA to determine the presence of IgG antibodies to the SARS CoV N protein Thirty six out of 37 patients 97 3 showed specific IgG seroconversion with titers ranging from 600 to 204 800 All positive samples were confirmed by Western blot assay Among those 36 IgG positive patients anti NH9004 121 protein IgG seroconversion rates were 22 2 69 4 and 100 within 7 days 2 weeks and 3 weeks after the onset of fever respec tively One patient did not have detectable IgG antibodies to the NH9004 121 protein This patient s serum