【病毒外文文献】2008 Severe acute respiratory syndrome coronavirus nucleocapsid protein confers ability to efficiently produce virus-lik

ORIGINAL PAPER Severe acute respiratory syndrome coronavirus nucleocapsid protein confers ability to efficiently produce virus like particles when substituted for the human immunodeficiency virus nucleocapsid domain Shui Mei Wang Yu Fen Chang Yi Ming Arthur Chen Chin Tien Wang Received 4 March 2008 Accepted 17 June 2008 Published online 1 July 2008 C211 National Science Council Taipei 2008 Abstract We replaced the HIV 1 nucleocapsid NC domain with different N coding sequences to test SARS CoV nucleocapsid N self interaction capacity and determined the capabilities of each chimera to direct virus like particle VLP assembly Analysis results indicate that the replacement of NC with the carboxyl terminal half of the SARS CoV N resulted in the production of wild type wt level virus like particles VLPs with the density of a wt HIV 1 particle When co expressed with SARS CoV N chimeras containing the N carboxyl terminal half sequence efficiently packaged N However the same was not true for the chimera bearing the N amino terminal half sequence despite its production of substantial amounts of VLPs According to further analysis HIV 1 NC replacement with N residues 2 213 215 421 or 234 421 resulted in effi cient VLP production at levels comparable to that of wt HIV 1 but replacement with residues 215 359 302 421 2 168 or 2 86 failed to restore VLP production to wild type levels The results suggest that the domain conferring the ability to direct VLP assembly and release in SARS CoV N is largely contained between residues 168 and 421 Keywords SARS CoV N C1 HIV 1 NC C1 Virus like particle assembly Introduction The novel infectious disease severe acute respiratory syndrome SARS 21 infected individuals in over 30 countries in 2002 and 2003 50 The causative agent was identified as the SARS coronavirus SARS CoV 13 21 The complete SARS CoV genome is approximately 30 kb long and contains 10 14 open reading frames 27 36 Like many other coronavirus species the SARS CoV is an enveloped virus containing three outer structural proteins spike S membrane M and envelope E 6 12 22 37 We know that nucleocapsid N proteins associated with viral genomic RNA form a viral core within the envelope 29 however SARS CoV assembly and budding pro cesses are not completely understood The co expression of coronavirus M with E 2 17 44 orN 19 35 is sufficient for particle formation According to these findings the co expression of at least two coronavirus structural proteins is required for virus like particle VLP formation In contrast retrovirus assembly with polyprotein precursor gag gene expression is sufficient for producing VLPs 14 Retroviral gag apparently possesses all required signals for VLP assembly and budding and functional domains involved in coronavirus VLP assembly and budding are allocated throughout the M E and N proteins Despite being completely unrelated the SARS CoV N protein and HIV 1 NC have similar properties both contain putative protein protein interaction domains and both play roles in viral RNA S M Wang C1 Y F Chang Institute of Public Health National Yang Ming University Taipei Taiwan ROC S M Wang C1 C T Wang GST N1 5 0 TAAAGGA TCCTCTGATAATGGACCC 3 0 forward 5 0 GCTCATCG ATTAGCTAGCCATTCGAGC 3 0 reverse GST N2 5 0 TG GCTGGATCCGGTGGTGAAACTGCC 3 0 forward 5 0 TC ATATCGATTTATGCCTGAGTTGAATC 3 0 reverse HIV 1 NC deletion mutants DNC and DPC were generated via recombinations of HIV gag mutants containing a BamHI linker inserted at nt 1907 1918 1940 or 2076 Recombinations of BamHI 2076 with BamHI 1940 BamHI 1907 and BamHI 1918 yielded constructs DNC DPC and delNC respectively Nucleotide sequences at breakpoints were DNC nt 1935 TTTAGGATCCAGGCT 2081 DPC nt 1902 AATTCAGG GATCCAGGCT 2081 and delNC nt 1912 CCATAAGG ATCCAGGCT 2081 To replace the HIV 1 NC with SARS Co N SARS CoV N cDNA fragments were PCR amplified with BamHI and or ClaI flanking primers Amplicons were gel purified digested with BamHI and or ClaI and ligated into DNC and DPC or into an HIV 1 gag mutant carrying ClaIand BamHI linker insertions at nt 1920 and 2076 respectively Primers used for making the designated constructs were DNC CoN and PC CoN 5 0 TAAAGGATCCTCTCTGAT AATGGACC 3 0 forward 5 0 TAAAGGATCCCCTGAGTT GAATCAGC 3 0 reverse DNC N2 and PC N2 5 0 ATGC GGATCCTGCAGGGTGAAACTGCCCTCGC 3 0 forward 5 0 TAAAGGATCCCCTGAGTTGAATCAGC 3 0 reverse NC CoN 5 0 AGACATCGATCTGATAATGGACC 3 0 forward 5 0 TAAAGGATCCCCTGAGTTGAATCAGC 3 0 reverse NC N1 5 0 AGACATCGATCTGATAATGGAC C 3 0 forward 5 0 TAAAGGATCCCCTGAGTTGAATCAG C 3 0 reverse NC N2 5 0 GAATGGATCGATTAGGTGGT GAAACT 3 0 forward 5 0 TAAAGGATCCCCTGAGTTGA ATCAGC 3 0 reverse NC N3 5 0 GAATGGATCGATTAG GTGGTGAAACT 3 0 forward 5 0 TGTTTGGATCCCGTC AATGTGCTTG 3 0 reverse NC N4 5 0 AGACATCGATG CAAAGTTTCTGGTA 3 0 forward 5 0 TAAAGGATCCCC TGAGTTGAATCAGC 3 0 reverse NC N5 5 0 CGCAATC GATGGCCGCAAATTGCA 3 0 forward 5 0 TAAAGGAT CCCCTGAGTTGAATCAGC 3 0 reverse NC N6 5 0 AGA CATCGATCTGATAATGGACC 3 0 forward 5 0 CCTTGG ATCCCTGTTGTTCCTTGAGG 3 0 reverse NC N7 5 0 AG ACATCGATCTGATAATGGACC 3 0 forward 5 0 GCTCA TCGATTAGCCAATTTGGTCAT 3 0 reverse Plasmid DNAs containing wt wtZiP and mutant KZiP leucine zipper domains of human CREB 24 were kindly provided by E Barklis 54 cDNA fragments of the wt and mutant leucine zipper domains were PCR ampli fied digested and ligated into DNC yielding the respective constructs DNC wtZiP and DNC KZiP The myristyla tion minus Myr HIV 1 gag mutant 45 defective in membrane association was used as a control for membrane binding assays All of the engineered constructs were cloned into the PR defective HIV 1 proviral expression vector HIVgptD25 47 Mutations were confirmed by restriction enzyme digestion or DNA sequencing Cell culture and transfection The 293T cells were maintained in Dulbecco s modified Eagle s medium DMEM supplemented with 10 fetal calf serum GIBCO Confluent 293T cells were 720 J Biomed Sci 2008 15 719 729 123 trypsinized and split 1 10 onto 10 cm dishes 24 h prior to transfection For each construct cells were transfected with 20 lg of plasmid DNA using the calcium phosphate pre cipitation method 50 lm chloroquine was added to enhance transfection efficiency Unless otherwise indi cated 10 lg of each plasmid was used for co transfection Culture supernatant and cells were harvested for protein analysis 2 3 days post transfection Western immunoblot At 48 72 h post transfection supernatant from transfected 293T cells was collected filtered and centrifuged through 2 ml of 20 sucrose in TSE 10 mM Tris HCl pH 7 5 100 mM NaCl 1 mM EDTA plus 0 1 mM phenylmethyl sulfonyl fluoride PMSF at 4C176C for 40 min at 274 000g Pellets were suspended in IPB 20 mM Tris HCl pH 7 5 150 mM NaCl 1 mM EDTA 0 1 SDS 0 5 sodium deoxycholate 1 Triton X 100 0 02 sodium azide plus 0 1 mM PMSF Next cells were rinsed with ice cold phosphate buffered saline PBS collected in IPB plus 0 1 mM PMSF and microcentrifuged at 4C176C for 15 min at 13 700g to remove cell debris Supernatant and cell sam ples were mixed with equal volumes of 29 sample buffer 12 5 mM Tris HCl pH 6 8 2 SDS 20 glycerol 0 25 bromphenol blue and 5 b mercaptoethanol and boiled for 5 min Samples were resolved by electrophoresis on SDS polyacrylamide gels and electroblotted onto nitrocellulose membranes Membrane bound Gag or chi meric proteins were immunodetected using a mouse monoclonal antibody directed against HIV 1 p24CA 46 Myc tagged SARS CoV N were probed with anti Myc Invitrogen monoclonal antibodies at a dilution of 1 5 000 respectively The secondary antibody was a sheep anti mouse or donkey anti rabbit horseradish peroxidase HRP conjugated antibody Invitrogen at 1 5 000 dilutions To detect GST and GST fusions anti GST HRP conjugate Amersham was used at a 1 5 000 dilution Horseradish peroxidase activity was detected according to the manu facturer s protocol GST pull down assay The 293T cells either mock transfected or transfected with GST fusion expression vectors were collected lysed in RIPA buffer 140 mM NaCl 8 mM Na 2 HPO 4 2mM NaH 2 PO 4 1 NP 40 0 5 sodium deoxycholate 0 05 SDS containing complete protease inhibitor cocktail Roche and microcentrifuged at 4C176C for 15 min at 13 700g 14 000 rpm to remove cell debris Aliquots of post nuclear supernatant PNS were mixed with equal amounts of 29 sample buffer and 5 b mercaptoethanol and held for Western blot analysis RIPA buffer was added to the remaining PNS samples to final volumes of 500 ll Each sample was mixed with glutathione agarose beads 30 ll Sigma and rocked for 2 h at 4C176C Bead bound complexes were pelleted washed tree times with RIPA buffer twice with PBS eluted at 19 sample buffer with 5 b mercaptoethanol boiled for 5 min and subjected to SDS 10 PAGE as described above Sucrose density gradient fractionation Supernatant cultures of transfected 293T cells were col lected filtered and centrifuged through 2 ml 20 sucrose cushions as described above Viral pellets were suspended in PBS buffer and laid on top of a pre made 20 60 sucrose gradient consisting of 1 ml layers of 20 30 40 50 and 60 sucrose in TSE that had been allowed to sit for 2 h Gradients were centrifuged in an SW50 1 rotor at 40 000 rpm 274 000g for 16 h at 4C176C 500 ll fractions were collected from top to bottom Sucrose den sity was measured for each fraction Proteins in each fraction were precipitated with 10 trichloroacetic acid TCA and subjected to Western immunoblotting Membrane flotation experiments At 48 h post transfection 293T cells were rinsed twice pelleted in PBS and resuspended in TE buffer 10 mM Tris HCl pH 7 5 1 mM EDTA containing 10 sucrose and complete protease inhibitor cocktail Cell suspensions were subjected to sonication followed by low speed centrifugation About 200 ll of post nuclear supernatant PNS was mixed with 1 3 ml of 85 5 sucrose in TE buffer placed at the bottom of a centrifuge tube and covered with a layer of 7 ml 65 sucrose mixed with 3 ml of 10 sucrose in TE buffer Gradients were centrifuged at 100 000g for 16 18 h at 4C176C Ten fractions were collected from top to bottom of each tube Proteins in each fraction were precipitated with ice cold 10 trichloroacetic acid TCA rinsed once with acetone and analyzed by Western immunoblot Results Expression and assembly of chimeric proteins containing a SARS CoV N coding sequence as a substitute for HIV 1 NC For purposes of roughly defining the self association involvement of the SARS CoV nucleocapsid N protein we fused the complete length GST CoN amino terminal half GST N1 or carboxyl terminal half GST N2 of the SARS CoV N coding sequence to the GST carboxyl J Biomed Sci 2008 15 719 729 721 123 terminus the expression of GST fusions was directed by a mammalian promoter Fig 1a Each resulting construct was co expressed with SARS CoV N CoN myc in 293T cells GST pull down assays were used to determine the ability of each GST fusion to interact with SARS CoV N Our results indicate that GST and GST N1 were incapable of pulling down SARS CoV N Fig 1b lanes 6 and 8 while GST CoN and GST N2 were capable of doing so lanes 7 and 9 This suggests that the domain responsible for N N interaction is largely contained within the car boxyl terminal region a finding compatible with those from previous reports 42 43 Next we tested whether the self interaction capacity of SARS CoV N was sufficient for rescuing the assembly defect of HIV 1 NC deleted mutants Full length or car boxyl terminal halves of SARS CoV were inserted in frames into the HIV 1 NC deleted mutants DNC DPC and delNC Fig 2a yielding chimeras DNC CoN DNC N2 PC CoN PC N2 NC CoN and NC N2 The DNC retained seven amino terminal NC residues and the DPC associated deletions extended to four carboxyl terminal SP1 residues Two residues were removed from the SP1 NC junction of the delNC Based on the possibility that the various NC mutations might impair VLP production to dif ferent degrees we reasoned that the extent to which VLP assembly was restored following N sequence insertion might reveal the self association capacity of each N sequence The backbone for all constructs was the PR defective HIV 1 expression vector HIVgptD25 referred to in this study as a wild type wt Each mutant was transiently transfected into 293T cells and subjected to Western immunoblotting to determine its ability to assemble and release VLPs As shown in Fig 2b chimeric proteins with predicted molecular weights corresponding to Pr55 gag containing a SARS CoV N coding sequence insertion in the NC region were readily detected Parental constructs with different extents of NC deletions were markedly defective in VLP production Fig 2b lane 3 and Fig 2c in particular the DPC VLP assembly was almost abolished Conversely inserting the carboxyl terminal half of SARS CoV N dramatically restored VLP production to wt level Fig 2b lanes 7 9 suggesting that the carboxyl terminal region of N that contains a putative self association domain is capable of counteracting the assembly defect when placed in the HIV 1 NC region Furthermore we noted that DNC CoN with over 400 inserted amino acid residues was still capable of directing VLP assembly and budding Fig 2b lane 4 In contrast PC CoN and NC CoN were moderately to markedly impaired in terms of VLP pro duction lanes 5 and 6 DNC N2 PC N2 and NC N2 possessed medium to cell p24CA associated protein ratios that were even higher than the wt ratio This result could be due either to increased assembly rate or to increased intracellular mutant degradation A slight correlation was observed between level of VLPs produced by chimeras containing full length N and the number of HIV 1 NC residues remaining in the deleted region Since NC CoN has almost all of its NC removed but retains intact SP1 NC and NC SP2 junctures we used NC CoN or NC N2 as models for studying the effects of inserted SARS CoV N on VLP assembly Sucrose density gradient fractionation analysis of chimeric VLPs The above results suggest that HIV 1 Gag containing a large sequence of approximately 200 400 residues inserted into the NC region is still capable of assembling and releasing VLPs Since the cultured 293T transfectant supernatant was centrifuged through 20 sucrose cushions for 40 min we believe the recovered viral proteins in the pelleted medium are virus associated However since the mutants contained large insertions we performed sucrose density gradient fractionation experiments to determine whether the large insertion mutations had any effect on virus particle density To make parallel comparisons with Fig 1 SARS CoV nucleocapsid protein self association a Sche matic representations of construct coding for recombinant SARS CoV N proteins CoN myc directed by a CMV promoter encoded full length SARS CoV N tagged with Myc at carboxyl terminus Boundaries of the RNA binding domain and self association domain are indicated 41 GST CoN GST N1 and GST N2 expressed GST fusion proteins with full length amino terminal half and carboxyl terminal half of N fused to GST carboxyl terminus respectively b c GST pull down assay 293T cells were co transfected with 10 lg of CoN myc and 10 lg of indicated GST fusion construct Aliquots of cell lysates preceding panel b and following panel c GST pull down were subjected to Western immunoblotting using anti GST and anti Myc antibodies as probes 722 J Biomed Sci 2008 15 719 729 123 wt HIV particle density NC CoN and NC N2 viral pellets were spun with wt pellets through the same sucrose density gradient The results show that both Pr55 gag and NC N2 had peaks in fraction 6 with a density of 1 17 g ml consistent with wild type HIV 1 particle density Fig 3 An NC CoN peak at fraction 7 with a density of approxi mately 1 19 g ml suggests that the encoded NC CoN was tightly packed when assembled into VLPs Mapping the SARS CoV N domain is required for replacing the HIV 1 NC assembly function Based on our observation that HIV 1 Gag containing SARS CoV N coding sequences as NC substitutes was capable of VLP assembly we tried to identify the SARS CoV N regions responsible for conferring the assembly function Toward this end we constructed a series of chi meras containing a variety of N coding regions as HIV 1 NC substitutes Fig 4a the ability of each chimera to produce VLPs was determined by Western blot analysis As shown in Fig 4b chimeras N1 N2 and N4 produced VLPs efficiently lanes 4 5 and 7 In contrast the VLP quantities produced by chimeras N3 N5 N6 and N7 were smaller than those produced by the wt Although VLP quantities produced by NC N1 are markedly higher than those produced by DNC CoN NC N5 and NC N6 the NC N1 release efficiency 43 is relatively lower than the three s This discrepancy may be due to different steady state intracellular levels relatively higher for NC N1 but lower for DNC CoN NC N5 and NC N6 Fig 2 Expression and assembly of chimeras containing SARS CoV N coding sequences to serve as substitutes for the HIV 1 NC domain a Schematic representations of wt HIV 1 Gag and mutant constructs Shown are mature HIV 1 Gag protein domain matrix MA capsid CA nucleocapsid NC p6 and two spacer peptides SP1 and SP2 DNC has ten HIV 1 NC residues remaining in the deleted region DPC has NC almost deleted with SP1 partially removed delNC has the two methionine residues bracketed in the SP1 NC junction removed Almost the entire codons 2 421 or carboxyl terminal half 215 421 of the SARS CoV nucleocapsid protein N coding sequence was inserted into the deleted NC region yielding the designated constructs Arrows indicate SP1 NC and NC SP2 junction sites Remaining HIV 1 NC residues in deleted regions are underlined Altered or foreign amino acid residues inserted in juncture area are italicized Backbone was the protease defective PR expression vector HIVgptD25 b c Expression and assembly of chimeric proteins 293T cells were transfected with 20 lg plasmid DNA for each indicated construct At 48 h post transfection cells and supernatant were collected for protein analysis as described in Materials and Methods Cell samples corresponding to 4 of total cell lysates and supernatant samples corresponding to 50 of total recovered viral pellets were fractionated using 10 SDS PAGE HIV 1 Gag or chimeric proteins were probed an anti p24CA monoclonal antibody or with a monoclonal antibody directed against N panel b upper panels Positions of wt HIV 1 Gag Gag Pol and molecular size markers are indicated p24CA associated proteins from medium or cell samples were quantified by scanning mutant and wt band densities from immunoblots Ratios of p24 gag associated protein levels in media to those in cells were determined for each construct and compared with wt release levels by dividing the release ratio for each mutant by the wt ratio in parallel experiments Relative release factor RF values are indicated J Biomed Sci 2008 15 719 729 723 123 Fig 4b lanes 13 15 19 and 20 In addition we cannot exclude the possibility of increased mutant VLP instability Note that N1 was capable of efficient VLP production Fig 4b lane 4 even though it could not effectively interact with the full length N Fig 1b These results suggest that the N sequence which is capable of conferring chimeric VLP assembly is located between residues 168 and 421 Based on evidence showing that the leucine zipper motif is competent in replacing the HIV NC assembly function we built a construct designated DNC wtZiP and contain ing a leucine zipper motif sequence to serve as a control We found that DNC wtZiP produces VLPs at a level comparable to that of wt Fig 4c lane 4 vs lane 2 In contrast DNC KZiP which contains a NC replacement consisting of a mutated leucine zipper motif was incapa ble of rescuing the DNC assembly defect VLP associated chimeric proteins were barely detected lane 5 Thus the SARS CoV N self association domain is similar to leucine zipper motifs in conferring chimeric ability to direct VLP assembly by promoting protein protein interactions Although SARS CoV N is genetically unrelated to Gag it is likely that N G