【病毒外文文献】2003 Identification of a Receptor-Binding Domain of the Spike Glycoprotein of Human Coronavirus HCoV-229E

JOURNAL OF VIROLOGY Feb 2003 p 2530 2538 Vol 77 No 4 0022 538X 03 08 00H110010 DOI 10 1128 JVI 77 4 2530 2538 2003 Copyright 2003 American Society for Microbiology All Rights Reserved Identification of a Receptor Binding Domain of the Spike Glycoprotein of Human Coronavirus HCoV 229E Aurelio Bonavia 1 Bruce D Zelus 1 David E Wentworth 1 Pierre J Talbot 2 and Kathryn V Holmes 1 3 Department of Microbiology 1 and Molecular Biology Program 3 University of Colorado Health Sciences Center Denver Colorado 80262 and INRS Institut Armand Frappier Laval Que bec Canada H7V 1B7 2 Received 2 April 2002 Accepted 19 November 2002 Human coronavirus HCoV 229E uses human aminopeptidase N hAPN as its receptor C L Yeager et al Nature 357 420 422 1992 To identify the receptor binding domain of the viral spike glycoprotein S we expressed soluble truncated histidine tagged S glycoproteins by using baculovirus expression vectors Trun cated S proteins purified by nickel affinity chromatography were shown to be glycosylated and to react with polyclonal anti HCoV 229E antibodies and monoclonal antibodies to the viral S protein A truncated protein S 547 that contains the N terminal 547 amino acids bound to 3T3 mouse cells that express hAPN but not to mouse 3T3 cells transfected with empty vector Binding of S 547 to hAPN was blocked by an anti hAPN monoclonal antibody that inhibits binding of virus to hAPN and blocks virus infection of human cells and was also blocked by polyclonal anti HCoV 229E antibody S proteins that contain the N terminal 268 or 417 amino acids did not bind to hAPN 3T3 cells Antibody to the region from amino acid 417 to the C terminus of S blocked binding of S 547 to hAPN 3T3 cells Thus the data suggest that the domain of the spike protein between amino acids 417 and 547 is required for the binding of HCoV 229E to its hAPN receptor Human coronavirus HCoV 229E is an enveloped positive stranded RNA virus in group 1 that causes common colds 18 Human aminopeptidase N hAPN a cell surface metallopro tease found on apical membranes of intestinal cells lung and kidney epithelial cells on macrophages and at synaptic junc tions serves as receptor for HCoV 229E 57 The deduced amino acid sequence of the gene that encodes the 200 kDa spike glycoprotein S of HCoV 229E suggests that the S pro tein is composed of a 15 amino acid aa signal sequence an N terminal S1 domain aa 16 to 560 an S2 domain aa 561 to 1173 containing several heptad repeat regions a transmem brane domain aa 1117 to 1138 and a short cytoplasmic tail aa 1139 to 1173 with a carboxy terminal cysteine cluster 31 The S protein has 30 potential sites for N glycosylation It is likely that the spikes on the HCoV 229E viral envelope are trimers of the S glycoprotein as shown for the spikes of a closely related coronavirus of pigs transmissible gastroenteritis virus TGEV 9 This paper reports studies to identify the receptor binding domain of the viral spike glycoprotein HCoV 229E only causes disease in humans so all studies on the pathogenesis of this virus have been done with human volunteers 45 At present there are very few isolates of HCoV 229E that can be propagated in human cell cultures including the strain isolated by Hamre and Procknow in the United States in 1966 15 and the LP strain isolated by Tyrrell et al in the United Kingdom in 1968 46 In this paper we have used the Hamre strain of HCoV 229E To initiate infection the spikes of HCoV 229E virions bind to hAPN on the plasma membrane of human cell lines or on the apical membranes of respiratory epithelial cells 47 57 HCoV 229E virions are neutralized by incubation at 37 C with soluble hAPN 4a Fusion of the TGEV envelope with host cell membranes occurs in endosomes 16 The molecular events that follow binding of a virion to its APN receptor have not been defined for group 1 coronaviruses However for mouse hepatitis virus in serogroup 2 binding at 37 C of the S protein to its receptor murine CEACAM1a CD66a leads to conformational changes in the carboxyl terminal domain S2 that may facilitate fusion of the viral envelope with the host cell plasma membrane 44 58 Three coronaviruses in serogroup 1 HCoV 229E TGEV and feline coronavirus and probably also canine coronavirus CCoV utilize the APN glycoprotein of their normal host species as a virus receptor 3 7 17 22 24 43 57 Although HCoV 229E can utilize either hAPN or feline APN fAPN as a receptor 43 57 it cannot utilize porcine APN pAPN 7 23 Kolb and collaborators identified a region of hAPN from aa 288 to 295 as essential for HCoV 229E infection A different region aa 717 to 813 on pAPN and the corresponding sites on fAPN and canine APN are essential for infection by TGEV feline coronavirus and CCoV respectively 6 17 Recent studies showed that the HCoV 229E receptor activity of hAPN can be abrogated by the addition of a single N linked glyco sylation site at amino acid 291 of hAPN corresponding to a naturally occurring N glycosylation site on pAPN 48 Thus it is possible that the four group 1 coronaviruses studied may bind to a common site found on APN proteins of all of these host species and that the species specificity of APN recognition by the viruses depends on other domains of the APN proteins that differ from one host species to another and impede the approach of S proteins of group 1 coronaviruses from other Corresponding author Mailing address Department of Microbi ology Campus Box B 175 University of Colorado Health Sciences Center 4200 E 9th Ave Denver CO 80220 Phone 303 315 7903 Fax 303 315 6785 E mail kathryn holmes uchsc edu Present address Department of Comparative Medicine Johns Hopkins University School of Medicine Retrovirus Laboratory Bal timore MD 21287 2530 hosts to the putative common conserved binding site 48 It is not yet known what domains of the S glycoproteins of human and porcine coronaviruses are responsible for their selective utilization of hAPN or pAPN respectively or what domain of S binds to the putative common receptor site on APN proteins of human and pigs This report describes the expression of purified soluble truncated S glycoproteins of HCoV 229E by using a recombi nant baculovirus expression system and it analyzes the inter actions of these truncated S proteins with polyclonal anti HCoV 229E antiserum anti S monoclonal antibodies MAbs and hAPN on the surface of living cells The region between aa 417 and 547 of the HCoV 229E S protein was found to be essential for binding to the hAPN receptor for HCoV 229E MATERIALS AND METHODS Cells Spodoptera frugiperda Sf9 cells Invitrogen Carlsbad Calif were maintained at 27 C in TC 100 medium JRH BioSciences Lenexa Kans with 10 fetal bovine serum Gemini Bioproducts Calabasas Calif and 2 anti biotics penicillin streptomycin and amphotericin B Gibco BRL Gaithersburg Md Murine 3T3 cells transfected with hAPN and 3T3 cells transfected with vector alone were obtained from T Look St Judes Memphis Tenn and were cultured as previously described 57 The myeloma cell line P3X63 AG8 653 and porcine ST cells were obtained from the American Type Culture Collection Rockville Md and were propagated as recommended Virus HCoV 229E was obtained from the American Type Culture Collection VR 740 The RW stock of HCoV 229E was propagated at 34 C in MRC5 cells as previously described A Bonavia and K V Holmes submitted for publica tion Plaque assays were done with MRC5 cells at 34 C Antibodies A polyclonal goat antiserum G1 directed against sucrose density gradient purified NP 40 disrupted HCoV 229E virions and preimmune goat serum were prepared in collaboration with L Sturman New York State Depart ment of Health Albany N Y Anti HCoV 229E MAbs were prepared by immunizing BALB c mice with 100 H9262g of semipurified HCoV 229E emulsified in complete Freund s adjuvant Difco Laboratories Detroit Mich At 3 week intervals two boosters of 100 H9262gof semipurified HCoV 229E in incomplete Freund s adjuvant Difco Laboratories were administered and mice were sacrificed 4 days after the last booster inoc ulation Spleen cells from immunized mice were fused with P3X63 AG8 653 myeloma cells Positive hybridoma clones were selected by immunofluorescence on L 132 cells infected with HCoV 229E WM15 a MAb directed against human aminopeptidase N hAPN CD13 was obtained from Biodesign International Kennebunk Maine Anti hAPN MAb BB1 was prepared by injecting Swiss Webster mice with membrane preparations of 3T3 cells expressing hAPN Treatment of mouse cell lines or rodent cell lines expressing hAPN with anti hAPN MAb BB1 blocked HCoV 229E infection in these cells A control mouse MAb of the same immunoglobulin G1 IgG1 isotype against cholera toxin B subunit was kindly provided by R Holmes University of Colorado Health Sciences Center Denver Colo IgG from polyclonal goat anti HCoV 229E antiserum G1 was purified on a protein A column Pierce Rockford Ill and then was adsorbed with either S 547 G1 S 547 S 417 G1 S 417 or S 268 G1 S 268 on Ni nitrilotriacetic acid superflow columns Qiagen Valencia Calif Virus neutralization Five thousand PFU of HCoV 229E was incubated at 4 C with serial 10 fold dilutions of polyclonal goat anti HCoV 229E antiserum in MRC5 medium pH 7 or control goat preimmune serum in a total volume of 200 H9262l After2hofincubation 300 H9262l of medium was added and plaque assays were performed with MRC5 cells at 34 C by using an overlay medium of mod ified Eagle s medium containing 0 45 Seakem LEagarose FMC Bioproducts Rockland Maine 8 heat inactivated fetal bovine serum and antibiotics Expression of histidine tagged soluble truncated HCoV 229E spike glycop roteins The S gene from HCoV 229E was reverse transcribed by using primer AB25 Table 1 with Superscript 2 Gibco Grand Island N Y in a 20 H9262l reaction mixture as described in the manufacturer s instructions The gene was amplified by PCR by using 1 H9262l of cDNA and primers S 23 and S 3600 Table 1 and then was cloned into pBCSkH11001 Stratagene La Jolla Calif The cDNA encoding the S gene was reamplified by using Pfu cloned polymerase Strat agene with primers BZ21 and BZ22 Table 1 and then was cloned into pCITE at the NcoI and XbaI sites Novagen Madison Wis The latter clone was used to amplify the cDNA sequences encoding the leader and the various regions of S with Pfu cloned polymerase Stratagene We used the baculovirus expression vector pAcMP2 TH PharMingen San Diego Calif that encodes a thrombin cleavage site and six histidine tag added to the C terminal part of the expressed proteins which were previously described 59 The cDNA encoding the N terminal 547 aa S 547 including the signal sequence was amplified with oligo nucleotides BZ21 and BZ22 417 aa S 417 amplified with BZ21 and AB84 and 268 aa S 268 amplified with BZ21 and AB91 NcoI and XbaI restriction sites were added to the 5H11032 and 3H11032 ends respectively to allow cloning into pAcMP2 TH Each construct was sequenced at the University of Colorado Health Sciences Center Cancer Center Core Sequencing Facility with primers BZ10 BZ14 AB29 AB31 AB41 and AB42 see Table 1 The baculovirus expression constructs were cotransfected with BaculoGold DNA PharMingen into Sf9 cells and progeny viruses were plaque purified according to the man ufacturer s instructions The resulting constructs called S 547 S 417 and S 268 produced soluble six histidine tagged glycoproteins Fig 1 Even though there is no protease cleavage site in the HCoV 229E S protein as there is in the spike protein of mouse virus MHV 28 we used the S1 S2 nomenclature to refer to S1 as the amino terminal half of the protein and S2 as the carboxy terminal half Purification of soluble histidine tagged truncated HCoV 229E S glycopro teins Large scale preparations of supernatant medium containing the soluble truncated proteins were purified with HiTrap nickel affinity columns Pharmacia Piscataway N J as previously described 59 After analysis by sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS PAGE and staining with silver data not shown the fractions containing the truncated S proteins were pooled and stored at H1100280 C Immunoblots The soluble receptor glycoproteins and prestained molecular size standards Bio Rad Hercules Calif were separated by SDS 12 5 PAGE transferred to Immobilon P membranes Millipore Bedford Mass and blocked overnight at 4 C in TBST 25 mM Tris pH 7 6 150 mM NaCl 0 1 TABLE 1 Cloning and sequencing primers Gene product Primer Sequence 5H11032 to 3H11032 Location a Vector BZ10 CGGATTTCCTTGAAGAGAGTG 4443 c Vector BZ14 CAGTCGTCCAATGCAAAGCGT 4268 S BZ21 CGCGACCATGGTTGTTTTGCTTGTTGCA 39 NcoI S BZ22 CGCGATCTAGAAACAGCGTCTGTGCAATT 1680 c XbaI S S 23 GTCTCAACTAAATAAAATGTTTGT 23 S S 3600R ACAGCAGACACAAGTTGCAAT 3600 c ORF4a b AB25 AGAGCCATTACTGTATGTGG 56 c S AB29 TGTGTCACAAACCTCTATTGC 767 S AB31 ATGTTGGTAGGTGGAGTGC 1105 S AB41 TCAGCATAAGAAGCTAACGC 754 c S AB42 CTTTAGGTAATGTAGAAGCCG 667 S AB84 ACTAGTCTAGACAATGAGCCTATAGTATAG 1284 c XbaI S AB91 GGGAAGGTCTAGAGGACAACTGGTCACATCT 842 c XbaI a From a published sequence 33 c complementary strand VOL 77 2003 RECEPTOR BINDING DOMAIN OF HCoV 229E S GLYCOPROTEIN 2531 Tween 20 supplemented with 5 powdered milk All subsequent steps were done in TBST buffer with 0 5 powdered milk Blots were incubated for 1 h with a 1 3 000 dilution of polyclonal goat anti HCoV 229E antiserum preabsorbed to mouse 3T3 cells After being washed the blots were incubated for 1 h with a 1 3 000 dilution of rabbit anti goat IgG conjugated to horseradish peroxidase HRP Cappel Aurora Ohio Bound HRP conjugated antibody complexes were detected with Renaissance Chemiluminescence Reagent DuPont NEN Boston Mass and images were exposed to autoradiography film Kodak Roch ester N Y PNGase treatments of truncated HCoV 229E S proteins Fifteen micrograms of the truncated HCoV 229E spike glycoprotein was incubated in Denaturing Buffer New England Biolabs Beverly Mass at 100 C for 10 min Upon cooling G7 Buffer New England Biolabs and NP 40 New England Biolabs buffer were added to a 1H11003 final concentration by following the manufacturer s directions Fifteen hundred units of PNGase F New England Biolabs was added to each sample and the samples were incubated for1hat37 C The deglycosylated proteins were separated by SDS 12 5 PAGE transferred to Immobilon P membrane Millipore paper and immunoblotted by using polyclonal goat anti HCoV 229E antiserum Enzyme linked immunosorbent assay ELISA Ninety six well Immulon plates Dynex Technologies Inc Franklin Mass were coated with 350 ng per well the purified truncated HCoV 229E spike proteins in 0 05 M carbonate buffer pH 9 6 Sigma St Louis Mo The plates were blocked overnight at 4 C in 5 bovine serum albumin BSA B3 buffer 0 15 M NaCl 0 05 M Tris HCl 0 8 mM EDTA 0 05 Tween 20 0 1 BSA pH 7 4 Plates were incubated with anti S MAbs 1 10 or polyclonal anti HCoV 229E antiserum 1 30 for1hat room temperature Bound antibodies were detected by using HRP conjugated goat anti mouse IgG or HRP conjugated rabbit anti goat IgG Cappel devel oped with o phenylenediaminedihydrochloride peroxidase substrate Sigma by following the manufacturer s directions Washes after every step and antibody dilution were performed in B3 buffer Receptor binding assays Flow cytometry analysis was used to assay binding of truncated HCoV 229E S proteins to hAPN on live cell membranes Mouse 3T3 cells stably transfected with empty vector 3T3 or 3T3 cells expressing recom binant hAPN hAPN 3T3 were incubated for1hat4 C with different amounts of nickel affinity purified truncated S proteins After three washes bound trun cated HCoV 229E S proteins were detected by flow cytometry analysis by using various anti S protein MAbs or polyclonal anti HCoV 229E antiserum and their respective isotypic or normal serum controls All incubations and washes were performed at 4 C in F buffer 0 1 BSA in phosphate buffered saline pH 7 4 RESULTS Characterization of truncated soluble histidine tagged HCoV 229E spike proteins expressed by baculovirus We con structed three baculovirus expression vectors that encoded sol uble truncated histidine tagged HCoV 229E spike glycopro teins S 547 S 417 and S 268 Fig 1 The secreted proteins were purified by nickel affinity chromatography from the superna tant medium from baculovirus infected Sf9 cell cultures The Ni affinity purified truncated HCoV 229E S proteins migrated in SDS 12 5 PAGE as broad bands Fig 2A The molecular sizes of the glycoproteins were larger than expected on the basis of their predicted amino acid composition Table 2 The larger apparent molecular sizes were largely due to N linked glycosylation That was shown by treating the proteins with PNGase F which removes N linked glycans Fig 2B The three truncated S glycoproteins were recognized in immuno blots by polyclonal goat anti HCoV 229E antiserum Fig 2A These data suggest that the truncated S proteins produced by baculovirus were folded and processed like wild type HCoV FIG 1 Diagram of the baculovirus expression constructs for expression of soluble six histidine tagged 6xH truncated HCoV 229E spike glycoprotein S The number next to the S indicates the amino acid at which the construct was truncated Each construct contains the HCoV 229E signal sequence The region corresponding to the TGEV receptor binding domain was identified by Godet et al 14 FIG 2 Characterization of the purified soluble truncated HCoV 229E spike proteins A Immunoblot of 1 2 H9262g of purified S 547 lane 1 S 417 lane 2 and S 268 lane 3 with polyclonal goat anti HCoV 229E antiserum B Immunoblot as for that in panel A of proteins treated with PNGase F 2532 BONAVIA ET AL J VIROL 229E spike glycoprotein Blots probed with preimmune goat serum showed no bands data not shown In general the sizes and the antigenicity of the soluble nickel affinity purified trun cated S glycoproteins expressed by baculovirus were as expected Purified truncated HCoV 229E spike proteins share epi topes with wild type HCoV 229E spike protein A panel of anti HCoV 229E MAbs recognized the three truncated HCoV 229E spike glycoproteins in ELISA assays Fig 3 An ti HCoV 229E MAbs 5 11H 6 5 1C 4 1 9C 3 4 6F 4 and 4 7B 2 detected each of the three truncated S proteins MAb 7 8D 4 detected S 547 and S 417 but not S 268 MAbs 4 9H 5 and 9 8E 12 detected S 547 but not S 417 or S 268 Figure 3 summarizes the likely sites of the epitopes on S that were recognized by each of the anti S MAbs MAb 3 10H 5 did not react to any of the truncated S proteins This MAb recognized the N protein of HCoV 229E in an immunoblot assay data not shown The control MAb directed against an irrelevant protein did not react to any of the HCoV 229E S proteins Therefore eight MAbs directed against HCoV 229E virions reacted with Ni affinity purified S 547 S 417 and or S 268 All antibodies were positive in immunofluorescence assays of susceptible infected cells and none showed neutralizing activity data not shown S 547 binds to the virus receptor hAPN on cell membranes Since the identification of the receptor for HCoV 229E 57 it has been logically assumed that the S glycoprotein of HCoV 229E interacts with hAPN We directly tested the hypothesis that the S glycoprotein binds to hAPN and that the receptor binding site lies in the S1 region Flow cytometry showed that S 547 but not S 417 or S 268 bound to mouse 3T3 cells that express the receptor hAPN hAPN 3T3 and that none of the three proteins bound to 3T3 cells that did not express the FIG 3 Binding of anti HCoV 229E MAbs to the three truncated HCoV 229E spike glycoproteins ELISA detection of 350 ng of S 547 S 417 and S 268 by using anti HCoV 229E MAbs followed by HRP conjugated anti mouse Igs The diagram below shows the probable locations of MAb binding epitopes in the linear map of the N terminal domain of the HCoV 229E spike protein OD 450 optical density at 450 nm TABLE 2 Molecular sizes of truncated HCoV 229E nickel affinity purified spike proteins a Truncation Predicted size kDa Size kDa with possible glycosylatio