【病毒外文文献】2002 Membrane Association and Dimerization of a Cysteine-Rich, 16-Kilodalton Polypeptide Released from the C-Terminal Re

JOURNAL OF VIROLOGY June 2002 p 6257 6267 Vol 76 No 12 0022 538X 02 04 00H110010 DOI 10 1128 JVI 76 12 6257 6267 2002 Copyright 2002 American Society for Microbiology All Rights Reserved Membrane Association and Dimerization of a Cysteine Rich 16 Kilodalton Polypeptide Released from the C Terminal Region of the Coronavirus Infectious Bronchitis Virus 1a Polyprotein Lisa F P Ng 1 and D X Liu 1 2 Institute of Molecular Agrobiology The National University of Singapore Singapore 117604 1 and School of Biological Sciences Nanyang Technological University Singapore 637616 2 Received 6 December 2001 Accepted 20 March 2002 More than 10 mature proteins processed from coronavirus gene 1 encoded polyproteins have been identified in virus infected cells Here we report the identification of the most C terminal cleavage product of the 1a polyprotein as a 16 kDa protein in infectious bronchitis virus infected Vero cells Indirect immunofluorescence demonstrated that the protein exhibits a distinct perinuclear punctate staining pattern suggesting that it is associated with cellular membranes Positive staining observed on nonpermeabilized cells indicates that the protein may get transported to the cell surface but no secretion of the protein out of the cells was observed Treatment of the membrane fraction prepared from cells expressing the 16 kDa protein with Triton X 100 a high pH and a high concentration of salts showed that the protein may be tightly associated with intracellular membranes Dual labeling experiments demonstrated that the 16 kDa protein colocalized with the 5H11541 bro mouridine 5H11541 triphosphate labeled viral RNA suggesting that it may be associated with the viral replication machinery Sequence comparison of the 16 kDa protein with the equivalent products of other coronaviruses showed multiple conserved cysteine residues and site directed mutagenesis studies revealed that these con served residues may contribute to dimerization of the 16 kDa protein Furthermore increased accumulation of the 16 kDa protein upon stimulation with epidermal growth factor was observed providing preliminary evidence that the protein might be involved in the growth factor signaling pathway The 27 6 kb genome length mRNA mRNA1 of the avian coronavirus infectious bronchitis virus IBV is composed of two large overlapping open reading frames ORFs 1a and 1b at the 5H11032 unique region It encodes a 441 kDa 1a polyprotein and a 1a 1b fusion polyprotein of 741 kDa by a frameshifting mechanism 6 7 8 Proteolytic processing of the 441 kDa 1a and 741 kDa 1a 1b polyproteins to smaller mature products is mediated by two proteinases namely a papain like proteinase and a picornavirus 3C like proteinase see Fig 1a The papa in like proteinase is involved in cleavage of the N terminal part of the 1a and 1a 1b polyproteins to release an 87 kDa protein and a 195 kDa protein in IBV infected cells 23 24 26 Sim ilar enzymatic activities were also identified for the first and second papain like proteinase domains of human and murine coronaviruses 1 2 3 11 14 17 20 21 36 45 Processing of the 1a and 1a 1b polyproteins at other positions is mediated by the 3C like proteinase This proteinase was shown to recognize several conserved Q S G and N dipeptide bonds resulting in the release of more than 10 mature products 4 16 18 19 25 27 28 29 31 32 33 34 36 39 44 and was identified as a 33 kDa protein for IBV 24 34 a 27 or 29 kDa protein for the coronavirus MHV A59 30 32 35 and a 34 kDa protein for human coronavirus 42 43 44 Recently immunofluorescence and biochemical studies with region specific antisera have suggested that 3C like proteinase and several other cleavage products may be membrane asso ciated and are colocalized with the viral RNA replication transcription machinery 4 5 10 34 36 37 38 41 44 A more recent study on MHV A59 suggested that only p28 the first cleavage product 9 12 might play a direct role in viral RNA synthesis together with polymerase and helicase while other cleavage products such as p1a 22 may segregate into different but tightly associated membrane populations that may have independent functions during viral replication 4 5 38 Elu cidation of the exact functions of these cleavage products would be essential for understanding the replication mecha nism of coronavirus One particularly interesting protein is the most C terminal cleavage product of the 1a polyprotein As a cysteine rich protein it was predicted to be a viral growth factor like protein 15 In this report we show the identification of a 16 kDa pro tein representing the most C terminal cleavage product of the IBV 1a polyprotein Indirect immunofluorescent staining of IBV infected Vero cells and Cos 7 cells expressing the 16 kDa protein showed a distinct perinuclear punctate staining pat tern Confocal microscopy and lateral laser sectioning demon strated that this protein is associated with intracellular mem brane structures and positive staining in nonpermeabilized cells suggested strongly that it gets transported to the cell surface However the protein cannot be secreted into the culture medium and no cleavable signal sequence was present in the N terminal region of the protein Treatment with deter gent an alkaline pH and a high salt concentration demon strated that the 16 kDa protein may be tightly associated with the intracellular membranes In addition dual labeling of IBV infected cells with 5H11032 bromouridine 5H11032 triphosphate BrUTP and anti 16 kDa protein serum showed that the 16 kDa pro Corresponding author Mailing address School of Biological Sci ences Nanyang Technological University 1 Nanyang Walk Block 5 Level 3 Singapore 637616 Phone 65 872 7000 Fax 65 872 7007 E mail dxliu ntu edu sg 6257 on March 13 2015 by AUBURN UNIVERSITY http jvi asm org Downloaded from tein was colocalized with viral RNA suggesting that it may be associated with the viral RNA replication machinery Se quence comparison with other members of the Coronaviridae family showed that the presence of multiple conserved cysteine residues and mutagenesis studies demonstrated that these cys teine residues could form interchain disulfide bonds resulting in dimerization of the 16 kDa protein Finally increased accu mulation of the 16 kDa protein was observed when cells ex pressing the protein were stimulated with epidermal growth factor EGF suggesting that the protein might be involved in the EGF signaling pathway MATERIALS AND METHODS Virus and cells The egg adapted Beaudette strain of IBV ATCC VR 22 obtained from the American Type Culture Collection was adapted to Vero cells and prepared as described previously 33 34 Virus stocks were prepared after the 62nd passage by infecting monolayers of Vero cells at a multiplicity of infection of approximately 0 1 PFU cell and harvested at 24 h postinfection The titer of the virus preparation was determined by plaque assay on Vero cells Vero Cos 7 and BHK 21 cells were grown at 37 Cin5 CO 2 and maintained in Dulbecco s modified minimal essential medium Gibco BRL Life Technolo gies supplemented with 10 newborn calf serum Radiolabeling of IBV infected Vero cells and transient expression of plasmid DNAs with the vaccinia virus T7 expression system Confluent monolayers of Vero cells grown on 60 mm diameter dishes were infected with IBV at a multi plicity of infection of approximately 2 PFU cell The cells were labeled with 35 S methionine cysteine at 25 H9262Ci ml at 4 h postinfection and harvested at 8 h postinfection Semiconfluent monolayers of Cos 7 cells grown on 60 mm dishes were in fected with 10 PFU of vTF7 3 per cell 13 and transfected with 12 H9262g of plasmid DNAs with 20 H9262l of Lipofectin liposomal transfection reagent in accordance with the instructions of the manufacturer Gibco BRL After incubation of the cells at 37 C for 7 h the cells were incubated in methionine and cysteine free medium ICN for 30 min and labeled with 25 H9262Ci of 35 S methionine cysteine 35S Express Protein Labeling Mix NEN Life Science per ml for 13 h The cells were scraped off the dishes in phosphate buffered saline and recovered by centrifu gation at 14 000 H11003 g for 1 min Cell fractionation of 35 S methionine cysteine labeled cells Radiolabeled cells were resuspended in hypotonic buffer 1 mM Tris HCl pH 7 4 0 1 mM EDTA 15 mM NaCl containing 2 H9262g of leupeptin per ml and 0 4 mM phenyl methylsulfonyl fluoride and broken by 20 strokes with a Dounce cell homoge nizer Cell debris and nuclei were removed by centrifugation at 1 500 H11003 g for 10 min at 4 C The membranes postnuclear fraction were pelleted by ultracen trifugation through a 6 sucrose cushion in a Beckman TLA 120 1 rotor 150 000 H11003 g for 30 min at 4 C Membrane pellets were resuspended in immu noprecipitation buffer 20 mM Tris HCl pH 7 4 5 mM EDTA 150 mM NaCl 0 5 sodium dodecyl sulfate SDS 0 1 sodium deoxycholate 0 5 Nonidet P 40 and the cytosol fraction supernatant was adjusted to the same volume and ion detergent conditions with 5H11003 immunoprecipitation buffer Samples were precleared by centrifugation incubated with specific antisera for 30 min at room temperature and then incubated with protein A Sepharose CL 4B Sigma for 30 min Immunoprecipitated beads were washed three times with the immuno precipitation buffer and analyzed by SDS polyacrylamide gel electrophoresis PAGE Radioimmunoprecipitation assay and SDS PAGE SDS PAGE was carried out with 15 polyacrylamide concentrations and the labeled polypeptides were detected by autoradiography or fluorography of dried gels as described previ ously 25 PCR Appropriate primers and template DNAs were used for amplification reactions with cloned Pfu DNA polymerase Stratagene under standard buffer conditions with 2 mM MgCl 2 Cell free transcription and translation Plasmid DNAs were expressed in rabbit reticulocyte lysate with a coupled transcription translation system TnT Promega in the presence of 35 S methionine Amersham Pharmacia Biotech in accordance with the instructions of the manufacturer One microgram of plasmid DNA was incubated in a 50 H9262l reaction mixture with or without 5 H9262l of canine pancreatic microsomal membranes Promega BrUTP labeling of de novo synthesized viral RNA IBV infected or mock infected Vero cells were treated with 20 H9262g of actinomycin D Sigma at 10 h postinfection for4htoshut off host cell mRNA transcription One millimolar BrUTP Sigma was introduced into cells by using 7 5 H9262l of SuperFect Qiagen and the cells were incubated for another 1 h before fixation and permeabilization for immunofluorescent staining as described below Indirect immunofluorescence microscopy and confocal microscopy Cells were grown on coverslips and infected with IBV or transfected with appropriate plasmid DNAs After washing with phosphate buffered saline containing 1 mM CaCl 2 and 1 mM MgCl 2 PBSCM the cells were fixed with 4 paraformalde hyde in PBSCM for 30 min at room temperature and permeabilized with 0 2 Triton X 100 in PBSCM followed by incubation with specific antiserum at room temperature for 2 h Antibodies were diluted in fluorescence dilution buffer PBSCM with 5 normal goat serum 5 newborn calf serum and 2 bovine serum albumin pH 7 6 The cells were then washed with PBSCM and incubated with fluorescein isothiocyanate or tetramethylrhodamine isothiocya nate conjugated anti rabbit or anti mouse immunoglobulin G Sigma in fluo rescence dilution buffer at 4 C for 1 h before mounting Confocal microscopy was performed on a Zeiss Axioplan microscope con nected to a Bio Rad MRC 1624 laser scanner equipped with an argon laser with appropriate filters Fluorescent images were superimposed to allow fine com parison and colocalization of green fluorescein isothiocyanate and red tetra methylrhodamine isothiocyanate signals in a single pixel produces yellow while separated signals are green or red Western blot analysis SDS PAGE of viral polypeptides was carried out as mentioned and viral proteins were transferred to nitrocellulose membranes Stratagene with a semidry transfer cell Bio Rad Trans Blot SD The mem branes were blocked overnight at 4 C in blocking buffer containing 5 skim milk powder in TBST 20 mM Tris HCl pH 7 4 150 mM NaCl 0 1 Tween 20 and incubated with specific antiserum diluted in blocking buffer 1 500 to 1 2 000 at room temperature for 2 h Membranes were washed three times with TBST further blocked in blocking buffer for 20 min at room temperature incubated with horseradish peroxidase conjugated anti rabbit or anti mouse immunoglob ulin G Dako diluted in blocking buffer 1 2 500 at room temperature for 1 h and then subjected to color development with detection reagents enhanced chemiluminescence ECL Construction of plasmids Plasmids pIBVM and pBP5 were described before 28 33 34 The IBV sequences present in these two constructs are from nucleotides 24430 to 27608 and 10752 to 12313 respectively Plasmid pIBV16K which covers nucleotides 11875 to 12312 and contains a UAG termination codon immediately downstream of the viral sequence was constructed by ligating a 437 bp PCR fragment into NcoI and BamHI digested pKT0 The cloning primers are LN 9 5H11032 GTCTTACCATGGAGTCTAAAGG GCAT 3H11032 and LDX 5 5H11032 GCTCCAGGATCCTATTGAACAGAAGA 3H11032 Plasmid pSinRep16K was cloned by ligating a 500 bp NheI and SmaI digested fragment from pIBV16K into XbaI and StuI digested pSinRep5 Invitrogen Plasmid pSinRepEGFR was constructed by cloning a 3 5 kb reverse transcrip tion PCR fragment coding for the EGF receptor EGFR from total RNA extracted from HeLa cells The XbaI and StuI digested 3 5 kb PCR fragment was cloned into XbaI and StuI digested pSinRep5 The cloning primers were EGFR 5H11032 5H11032 GCAGCGTCTAGAATGCGACCCTCCGGG 3H11032 and EGFR 3H11032 5H11032 CCGTGGAGGCCTTCATGCTCCAATAAA 3H11032 Plasmid pT716K was cloned by ligating a BglII and BamHI digested fragment from pIBV16K into BamHI digested vector pT7H927810 34 containing the T7 tag sequence All subse quent mutant forms with the cysteine residues mutated to alanine were con structed by site directed mutagenesis RESULTS Identification of the 16 kDa protein in IBV infected Vero cells We have previously shown that two Q S dipeptide bonds Q 3783 S 3784 and Q 3928 S 3929 encoded by nucleotides 11875 to 11880 and 12310 to 12315 respectively are cleavage sites of the IBV 3C like proteinase 27 28 Cleavage at these two positions would result in the release of a polypeptide with a calculated molecular mass of 15 4 kDa Fig 1a To identify this product a region specific polyclonal antiserum anti 16 kDa protein serum was raised in rabbits against the IBV sequence encoded between nucleotides 11878 and 12312 with protein expressed in Escherichia coli The initial application of this antiserum for identification of the predicated cleavage product in IBV infected cell lysates 6258 NG AND LIU J VIROL on March 13 2015 by AUBURN UNIVERSITY http jvi asm org Downloaded from proved difficult due to the high background level Various ways were attempted to enrich the protein and reduce the back ground and the protein was successfully identified in IBV infected Vero cells after removing the nuclear fraction from total cell lysates by centrifugation at low speed 1 500 H11003 g at 4 C for 10 min As shown in Fig 1b a polypeptide with an apparent molecular mass of 16 kDa was specifically identified in IBV infected Vero cells lane 1 but not in mock infected FIG 1 a Diagram of ORFs 1a and 1b illustrating the two overlapping papain like proteinase domains PLPDs the 3C like proteinase 3CLpro the RNA dependent RNA polymerase the metal binding domain and the helicase The Q 3783 S 3784 and Q 3928 S 3929 scissile bonds and 16 kDa viral product generated by cleavage with the 3C like proteinase are indicated Also shown are the IBV sequence recognized by anti 16 kDa protein serum the stretches of hydrophobic residues M1 and M2 encoded by ORF 1a and the amino acid sequence and hydropathy plot 22 of the 16 kDa protein The molecular mass of the 16 kDa protein was estimated on the basis of its migration on SDS PAGE The Q 3783 S 3784 and Q 3928 S 3929 residues are encoded by nucleotides 11 875 to 11 880 and 12 310 to 12 315 respectively The 12 cysteine residues are in bold b Detection of the 16 kDa protein in IBV infected Vero cells IBV infected IBV and mock infected Mock Vero cells were labeled with 35 S methionine cysteine and harvested at 12 h postinfection The cell debris and nuclei fractions were removed by low speed centrifugation 1 500 H11003 g for 10 min and the cytosol and membrane fractions were separated by high speed centrifugation 150 000 H11003 g The cytosol and membrane fractions were immunoprecipitated with anti 16 kDa protein serum and anti M serum Polypeptides were separated on an SDS 15 polyacrylamide gel and detected by fluorography The values on the left are molecular sizes in kilodaltons VOL 76 2002 CYSTEINE RICH 16 kDa PROTEIN OF CORONAVIRUS IBV 6259 on March 13 2015 by AUBURN UNIVERSITY http jvi asm org Downloaded from cells lane 2 The 16 kDa protein may represent the cleavage product released from the Q 3783 S 3784 and Q 3928 S 3929 dipep tide bonds In a control experiment the postnuclear fractions of cell lysates prepared from IBV infected and mock infected Vero cells were subjected to an immunoprecipitation assay with anti M serum The anti M serum specifically detected the IBV membrane protein M in IBV infected cells Fig 1b lane 3 but not in mock infected cells Fig 1b lane 4 Membrane association and colocalization of the 16 kDa protein with de novo synthesized viral RNA Subcellular local ization of the 16 kDa protein was first studied by fusing the protein with the green fluorescent protein GFP to gain initial clues to where the protein is localized in cells Transfection of Cos 7 cells with pEGFP 16k showed a perinuclear punctate staining pattern Fig 2a part A while the GFP control showed a diffuse distribution pattern Fig 2a part B suggest ing that the fusion protein may be localized to intracellular membrane compartments Indirect immunofluorescent stain ing of IBV infected Vero cells fixed with 4 paraformalde hyde at 10 h postinfection with anti 16 kDa protein serum showed a staining pattern similar to that of the GFP 16 kDa fusion protein Fig 2a part C No positive staining was ob served in mock infected cells Fig 2a part D Several Nidovirales ORF 1a products were recently shown to FIG 2 a Subcellular localization of the 16 kDa protein A Cos 7 cells overexpressing pEGFP 16k at 16 h posttransfection showing perinuclear staining B Cos 7 cells overexpressing the EGFP control vector pEGFP showing diffuse staining C Immunofluorescent staining of IBV infected Vero cells with anti 16 kDa protein serum 1 20 at 13 h postinfection showing distinct punctate perinuclear staining D Im munofluorescent staining of mock infected Vero cells with anti 16 kDa protein serum 1 20 at 13 h postinfection E Double labeling of IBV infected Vero cells that were transfected with BrUTP at 10 h postinfection showing the staining profile of anti 16 kDa protein serum F Double labeling of IBV infected Vero cells that were transfected with BrUTP at 10 h postinfection showing the staining pattern of anti BrUTP serum G Superimposition of images E and F All images were taken from a Zeiss Axioplan confocal microscope b Membrane association of the 16 kDa protein Cos 7 cells expressing the 16 kDa protein were labeled with 35 S methionine cysteine for 4 h and harvested Cells were lysed with a Dounce homogenizer and fractionated into membrane M and cytosol C fractions at pH 7 lanes 1 and 2 by ultracentrifugation Polypeptides were immunoprecipitated with anti 16 kDa protein serum separated on an SDS 15 polyacrylamide gel and detected by fluorog raphy Membrane M pellets were resuspended in hypotonic buffer treated with 1 Triton X 100 TX 100 100 mM Na 2 CO 3 or 1 M KCl and further fractionated into supernatant S and pellet P fractions by ultracentrifugation Polypeptide