【病毒外文文献】2004 Coronavirus Spike Glycoprotein, Extended at the Carboxy Terminus with Green Fluorescent Protein, Is Assembly Compet

JOURNAL OF VIROLOGY July 2004 p 7369 7378 Vol 78 No 14 0022 538X 04 08 00H110010 DOI 10 1128 JVI 78 14 7369 7378 2004 Copyright 2004 American Society for Microbiology All Rights Reserved Coronavirus Spike Glycoprotein Extended at the Carboxy Terminus with Green Fluorescent Protein Is Assembly Competent Berend Jan Bosch Cornelis A M de Haan and Peter J M Rottier Virology Division Department of Infectious Diseases and Immunology Faculty of Veterinary Medicine and Institute of Biomembranes Utrecht University 3584 CL Utrecht The Netherlands Received 27 October 2003 Accepted 5 March 2004 Due to the limited ultrastructural information about the coronavirion little is known about the interactions acting at the interface between nucleocapsid and viral envelope Knowing that subtle mutations in the carboxy terminal endodomain of the M protein are already lethal we have now probed the equivalent domain of the spike S protein by extending it terminally with a foreign sequence of 27 kDa the green fluorescent protein GFP When expressed individually in murine cells the S GFP chimeric protein induced the formation of fluorescent syncytia indicating that it was synthesized and folded properly trimerized and transported to the plasma membrane where it exhibited the two key S protein functions i e interaction with virus receptor molecules and membrane fusion Incorporation into virus like particles demonstrated the assembly compe tence of the chimeric spike protein The wild type S gene of mouse hepatitis coronavirus MHV was subse quently replaced by the chimeric construct through targeted recombination A viable MHV SGFP was ob tained infection by which could be visualized by the fluorescence induced The efficiency of incorporation of the chimeric protein into particles was however reduced relative to that in wild type particles which may explain at least in part the reduced infectivity produced by MHV SGFP infection We conclude that the incorporation of spikes carrying the large GFP moiety is apparently impaired by geometrical constraints and selected against during the assembly of virions Probably due to this disadvantage deletion mutants having lost the foreign sequences rapidly evolved and outcompeted the chimeric viruses during virus propagation The fluorescent MHV SGFP will now be a convenient tool to study coronaviral cell entry Enveloped viruses acquire their lipid envelope by budding from cellular membranes This budding process involves the specific association of viral membrane proteins and capsid pro tein together with the viral genomic RNA DNA into a virus particle The selective inclusion of viral proteins generally re sults in the exclusion of the abundantly present cellular pro teins from the virus particle in such a way that the protein content of the virion is essentially of viral origin This is estab lished by affinity interactions among the viral proteins in addi tion to the concentration of the viral proteins at the site of budding at membrane microdomains Alphaviruses do not al low the incorporation of host proteins probably because of the extensive and specific interactions between the spikes them selves and with the nucleocapsid during the budding process However retroviruses dependent for budding only on the Gag protein seem to incorporate many cellular membrane pro teins which are present at the site of budding reviewed in reference 18 The inclusion of host proteins apparently de pends strongly on the structural organization of enveloped viruses Coronaviruses are among the largest enveloped RNA vi ruses measuring 80 to 120 nm in diameter They contain a helical nucleocapsid which consists of an H1101130 kb positive stranded RNA genome encapsidated by the nucleocapsid pro tein N H1101160 kDa The nucleocapsid is incorporated into a viral particle by budding into the early compartments of the exocytic pathway 23 24 44 thereby acquiring the viral en velope The viral membrane accommodates at least three dif ferent membrane proteins a type III triple membrane span ning membrane protein M H1101125 kDa a small hydrophobic envelope protein E H1101110 kDa and the large type I spike protein S H11011200 kDa Some coronaviruses also contain the hemagglutinin esterase protein HE H1101165 kDa 39 The M and E proteins are essential for virus budding Coexpression of these proteins leads to nucleocapsid independent budding of coronavirus like particles VLPs 45 Incorporation of spikes into virions and VLPs is mediated by interaction of the S protein with the M protein 7 32 45 The M protein also facilitates the nucleocapsid packaging into virions by interac tion with the nucleocapsid protein 26 and with the genomic RNA 17 30 The mouse hepatitis coronavirus A59 MHV A59 spike protein is a class I membrane fusion protein 2 and is solely responsible both for virus entry and for cell cell fusion The spikes appear on the virion as large characteristic surface pro jections ca 20 nm in length The S protein is synthesized in the rough endoplasmic reticulum where it folds and oligomerizes slowly 31 46 into dimers 27 48 or trimers 9 A fraction of the protein is transported to the plasma membrane where it induces cell cell fusion In the virion the 1 324 amino acid aa membrane protein consists of a large 1 263 aa extensively N glycosylated amino terminal ectodomain a hydrophobic 29 aa transmembrane domain TM and a short 32 aa hydrophilic carboxy terminal endodomain Upon passage through the Golgi compartment the 180 kDa spike may be cleaved by furin like enzymes unpublished results into two subunits S1 and S2 of approximately the same size which Corresponding author Mailing address Virology Division De partment of Infectious Diseases and Immunology Yalelaan 1 3584CL Utrecht The Netherlands Phone 31 30 2532485 Fax 31 30 2536723 E mail p rottier vet uu nl 7369 on March 12 2015 by UNIV OF NEBRASKA LINCOLN http jvi asm org Downloaded from remain noncovalently linked The S1 subunit is responsible for receptor binding 1 20 42 whereas the membrane bound S2 subunit is involved in membrane fusion 49 The TM and or endodomain of S is responsible for interaction with the M protein and incorporation into the virion 19 In the present study we investigated the structural require ments for coronavirus assembly Little is known about the structural organization of coronaviruses Ultrastructural re search on coronaviruses based on crystallography and electron microscopy has been hampered by the pleiomorphic nature of these viruses The structure of the nucleocapsid is still unre solved and it is unknown how it fits to the viral membrane and to the luminal parts of the membrane proteins E M and S Mutagenesis studies on the MHV M protein have shown that subtle changes in the carboxy terminus were already fatal and impaired the assembly of viral particles 5 Just like those of the M and E proteins the membrane exposed carboxy termi nal part of S is rather short and the function of this domain is currently unknown The cytoplasmic domain of S might be involved in interaction with the M protein and or the nucleo capsid To get more insight into this matter we made use of our recently established targeted recombination system in or der to test whether modification of the carboxy terminus of S is tolerated Rather than starting by making subtle mutations we decided to extend the domain substantially by a foreign sequence Thus we tested whether appending the sequence of the green fluorescent protein GFP would be tolerated If so this would provide us at the same time with a recombinant virus suitable for future studies for instance on viral entry In the S GFP fusion protein constructed the cytoplasmic domain was extended by 282 residues This protein was found to be fusion active and to be incorporated into VLPs Using targeted RNA recombination a viable recombinant virus MHV SGFP was obtained in which the spike gene was re placed by the S GFP gene This virus indeed contained the fusion protein and was fluorescent Genetic stability experi ments revealed that the GFP gene was not maintained result ing in the gradual loss of GFP sequences during passage of the virus MATERIALS AND METHODS Virus cells and antibodies The preparation of recombinant wild type MHV A59 MHV WT has been described previously 6 Recombinant vaccinia virus encoding the T7 RNA polymerase vTF7 3 was obtained from B Moss OST7 1 12 obtained from B Moss and LR7 cells 25 were maintained as monolayer cultures in Dulbecco modified Eagle medium DMEM containing 10 fetal calf serum FCS 100 IU of penicillin ml 100 H9262g of streptomycin ml DMEM FCS all from Life Technologies The monoclonal antibody MAb J1 3 against the amino terminus of MHV M anti M 43 and the MAb WA3 10 directed against the MHV S protein anti S 16 were kindly provided by J Fleming University of Wisconsin Madison The production of polyclonal antiserum K134 to MHV A59 anti MHV has been described previously 36 The goat anti rabbit red fluorescent antibody Cy5 was purchased from Jackson Immunoresearch Labo ratories and the polyclonal antiserum against GFP anti GFP was purchased from Clontech Plasmid constructs Expression vectors used in the vTF7 3 expression system contained the genes under the control of the bacteriophage T7 transcription regulatory elements The expression constructs pTUMM pTM5ab and pTUMS contain the genes encoding the MHV A59 M E and S proteins respectively cloned into the pTUG31 plasmid 45 47 The plasmid pTUGS GFP encoding the S GFP protein was created in three stages First the BamHI StyI fragment of the pTUMS plasmid 45 corresponding to the ectodomain of the MHV A59 S protein was blunted by using the Klenow enzyme The fragment was cloned into the BamHI linearized and blunted pTUG31 vector 47 The resulting vector was designated pMHVSH9004TMCD and contained the sequence encoding the S ectodomain under a T7 promoter with a unique BamHI site at its 5H11032 end Second the pMHVSH9004TMCD vector was digested with BamHI and blunted by using Klenow enzyme followed by heat inactivation of the enzyme After re striction with the MluI enzyme the linearized pMHVSH9004TMCD vector was isolated from an agarose gel Primer 974 5H11032 GTGGATCCATCGAAGGTCGT AATGCAAATGCTGAAGC 3H11032 and primer 1508 5H11032 AGATCTCTGCAGCG GCCGCGATAGTGGATCCTCATGAGAG 3H11032 were used to amplify by PCR the H110111 kb sequence of the 3H11032 end of the S gene by using the pTUMS plasmid as a template Primer 1508 lacks the stop codon of spike gene and contains an overhang with a BamHI a NotI and a PstI site The PCR product was digested with MluI and the 400 bp fragment containing the 3H11032 end of the S gene was purified from agarose gel and ligated into the linearized and MluI treated pMHVSH9004TMCD vector The resulting vector contained the entire spike gene except the stop codon under a T7 promoter and was designated pTUGS stop H11002 Third the final pTUGS GFP vector was created by ligating the BamHI NotI fragment of pEGFP N3 Clontech into the BamHI NotI digested pTUGS stop H11002 vector The final construct was verified by DNA sequencing The transcription vector pXHSGFP needed to produce donor RNA for the construction of recombinant MHV SGFP via targeted recombination was cre ated by ligation of the MluI PstI fragment of pTUGS GFP into the MluI Sse8387I digested pMH54 vector 25 Construction of recombinant MHV SGFP The chimeric S GFP gene was transferred into the MHV genome by targeted RNA recombination as described previously 6 22 Capped runoff donor RNAs transcribed from the PacI truncated pXHSGFP vector were electroporated into feline FCWF cells that had been infected 4 h earlier by fMHV 25 These cells were then divided over two T25 flasks containing a monolayer of LR7 cells to obtain two independent recombinant viruses MHV SGFP A and B Progeny viruses released into the medium were harvested and candidate recombinants were selected by two rounds of plaque purification on LR7 cells Confocal laser scanning microscopy CLSM Confocal images of S GFP transfected OST7 1 cells MHV SGFP infected LR7 cells or fluorescent MHV SGFP virions were taken on a Leica inverted fluorescence microscope equipped with an argon and helium ion laser and with a H1100340 or H11003100 oil immersion objective lens Enhanced GFP was excited at 488 nm Cy5 was excited at 568 nm Growth curves Confluent monolayers of LR7 cells in 35 mm dishes were infected with either MHV WT or MHV SGFP at a multiplicity of infection MOI of 1 followed by incubation for1hat37 C Cells were subsequently washed with DMEM and then fed with DMEM FCS Samples from the culture medium taken at different times postinfection p i were titrated by an endpoint dilution assay and titers expressed as 50 tissue culture infectious doses TCID 50 were calculated Passaging of MHV SGFP and RT PCR analysis The MHV SGFP virus was passaged for six successive rounds on LR7 cells at an MOI of 0 05 The presence of the inserted GFP gene was checked by reverse transcription PCR RT PCR on samples taken from the culture fluids An RT reaction was performed on the MHV SGFP and MHV WT genome by using primer 1261 5H11032 GCTGCTTACT CCTATCATAC 3H11032 which is complementary to the open reading frame 5 ORF5 region A PCR was performed on the RT product by using primer 935 5H11032 GCACAGGTTGTGGCTCATG 3H11032 and primer 1090 5H11032 GATTCAGGTTT GTAACATAATCTAGAGTCTTAGG 3H11032 These primers map in the ectodo main of the S gene and the ORF4 TRS respectively The two plasmid vectors used to construct MHV WT pMH54 and MHV SGFP pXHSGFP were taken along as controls The PCR products obtained for MHV SGFP A and B passage 6 were cloned into pGEM T Easy and subsequently sequenced by using primer 935 Immunofluorescence The percentage of S GFP expressing viruses of MHV SGFP A and B at passages 1 2 4 and 6 was determined by immunofluorescence LR7 cells grown on 12 mm coverslips were infected in DMEM at an MOI of 0 5 At 1 h p i cells were washed with DMEM and overlaid with DMEM FCS containing 1 H9262M HR2 2 to prevent cell cell fusion At 8 h p i cells were fixed permeabilized and labeled as described previously 31 with the anti MHV serum 1 400 in combination with a red fluorescent Cy5 secondary antibody 1 200 The percentage of green fluorescent cells GFP positive over red flu orescent cells MHV positive was determined by random counting of 100 cells Vaccinia virus infection DNA transfection and metabolic labeling of OST7 1 cells Subconfluent monolayers of OST7 1 cells in 10 cm 2 tissue culture dishes were inoculated with vTF7 3 in DMEM at an MOI of 10 At 1 h p i cells were washed with DMEM and overlaid with transfection medium consisting of 0 2 ml of DMEM that contained 10 H9262l of Lipofectin Life Technologies 5 H9262gof pTUMM 1 H9262g of pTM5ab and 2 H9262g of either pTUMS or pTUGS GFP After 7370 BOSCH ET AL J VIROL on March 12 2015 by UNIV OF NEBRASKA LINCOLN http jvi asm org Downloaded from 10 min at room temperature 0 8 ml of DMEM was added and incubation was continued at 37 C At 4 5 h p i cells were washed with DMEM and starved for 30 min in cysteine and methionine free minimal essential medium containing 10 mM HEPES pH 7 2 without FCS The medium was subsequently replaced by 600 H9262l of the same medium containing 100 H9262Ci of 35 S in vitro labeling mixture Amersham At 6 h p i the radioactivity was chased by incubating the cells with 2 ml of DMEM containing 2 mM methionine and cysteine After 3 h the dishes were placed on ice and the culture media were collected and cleared by cen trifugation for 15 min at 4 000 H11003 g and 4 C Cells were washed with ice cold phosphate buffered saline PBS and lysed with 600 H9262l of detergent buffer 50 mM Tris Cl pH 8 0 62 5 mM EDTA 0 5 sodium deoxycholate 0 5 Nonidet P 40 containing 1 mM phenylmethylsulfonyl fluoride Lysates were cleared by centrifugation for 10 min at 13 000 H11003 g at 4 C Viral proteins in the cell lysates and VLPs in the culture medium were subjected to immunoprecipitation in the presence or absence affinity purification of detergents respectively Cell lysates 100 H9262l or cleared culture medium 300 H9262l were diluted 2 5 times with deter gent buffer or with TEN buffer 10 mM Tris pH 7 6 1 mM EDTA 50 mM NaCl respectively and subsequently incubated overnight at 4 C with the anti MHV serum 2 H9262l or the anti S MAb 20 H9262l The immune complexes were adsorbed to Pansorbin cells Calbiochem for 30 min at 4 C and collected by low speed centrifugation Pellets were washed three times by resuspension and centrifugation with either detergent buffer cell lysates or TEN buffer culture medium Pellets were resuspended and heated in Laemmli sample buffer at 95 C for 2 min before being analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS PAGE in 15 polyacrylamide gels Infection and metabolic labeling of LR7 cells Subconfluent monolayers of LR7 cells in 10 cm 2 dishes were inoculated with either MHV WT or MHV SGFP A or B passage 2 in DMEM at an MOI of 1 for 1 h Subsequently cells were washed with DMEM and incubated under DMEM FCS At 5 5 h p i the cells were washed with DMEM and starved for 30 min in cysteine and methi onine free MEM containing 10 mM HEPES pH 7 2 The culture medium was then replaced by 600 H9262l of the same medium but containing 100 H9262Ci of 35 Sin vitro labeling mixture Amersham At 7 h p i the radioactivity was chased by incubating the cells with DMEM containing 2 mM methionine and 2 mM cys teine After 2 h the cells were placed on ice and the culture media were collected and cleared by centrifugation for 15 min at 4 000 H11003 g and 4 C Cells were washed with ice cold PBS and lysed with lysis buffer 20 mM Tris pH 7 6 150 mM NaCl 0 5 sodium deoxycholate 1 Nonidet P 40 0 1 SDS Ly sates were cleared by centrifugation for 10 min at 13 000 H11003 g at 4 C Cell lysates were diluted 2 5 times with lysis buffer The cleared culture media were supple mented with 1 4 volume of 5H11003 lysis buffer Viral proteins in the cell lysates and culture media were incubated overnight at 4 C with the anti MHV serum 2 H9262l the anti S MAb 20 H9262l or the anti GFP serum 1 H9262l Clontech The immune complexes were adsorbed to Pansorbin cells for 30 min at 4 C and were subse quently collected by low speed centrifugation Pellets were washed three times with lysis buffer Pellets were resuspended and heated in Laemmli sample buffer at 95 C for 2 min before being analyzed by SDS PAGE in 15 polyacrylamide gels For quantification of the relative presence of the viral proteins in coronavirus particles released into the culture medium the above procedure was modified slightly The cleared culture media were again diluted 2 5 times with TEN buffer but the particles were affinity purified with either the anti M MAb 20 H9262l or the anti S MAb 20 H9262l Pellets were washed three times with TEN buffer Quanti fication of the radioactivities in the protein bands in the dried gels was carried out by phosphorscanning of dried gels by using a Storm 860 Molecular Dynam ics Virus purification Virus present in the culture medium of infected cells was partially purified as follows The virus containing medium was centrifuged at 3 000 rpm for 5 min and the supernatant was centrifuged again for 5 min at 15 000 rpm to remove any cell debris and nuclei Virus in the supernatant was subsequently pelleted through a 20 sucrose cushion for2hat25 000 rpm and 4 C by using an SW28 rotor The virus pellet was carefully resuspended in 100 H9262l ofPBSfor4honice RESULTS Construction and functional analysis of S GFP fusion pro tein To evaluate whether extension of the relatively short coronavirus spike endodomain by a long polypeptide would affect the protein s biological functions and in particular whether this would impair incorporation into particles to yield infectious virus we appended the enhanced GFP gene to the carboxy terminal end of the S gene in an expression vector via a short linker sequence corresponding to 5 aa residues The resulting carboxy