【病毒外文文献】2007 Participation of both Host and Virus Factors in Induction of Severe Acute Respiratory Syndrome (SARS) in F344 Rats

JOURNAL OF VIROLOGY Feb 2007 p 1848 1857 Vol 81 No 4 0022 538X 07 08 00H110010 doi 10 1128 JVI 01967 06 Copyright 2007 American Society for Microbiology All Rights Reserved Participation of both Host and Virus Factors in Induction of Severe Acute Respiratory Syndrome SARS in F344 Rats Infected with SARS Coronavirus H17188 Noriyo Nagata 1 Naoko Iwata 1 Hideki Hasegawa 1 Shuetsu Fukushi 2 Masaru Yokoyama 3 Ayako Harashima 1 Yuko Sato 1 Masayuki Saijo 2 Shigeru Morikawa 2 and Tetsutaro Sata 1 Departments of Pathology 1 and Virology I 2 and Center for Pathogen Genomics 3 National Institute of Infectious Diseases Tokyo Japan Received 9 September 2006 Accepted 20 November 2006 To understand the pathogenesis and develop an animal model of severe acute respiratory syndrome SARS associated coronavirus SARS CoV the Frankfurt 1 SARS CoV isolate was passaged serially in young F344 rats Young rats were susceptible to SARS CoV but cleared the virus rapidly within 3 to 5 days of intranasal inoculation After 10 serial passages replication and virulence of SARS CoV were increased in the respiratory tract of young rats without clinical signs By contrast adult rats infected with the passaged virus showed respiratory symptoms and severe pathological lesions in the lung Levels of inflammatory cytokines in sera and lung tissues were significantly higher in adult F344 rats than in young rats During in vivo passage of SARS CoV a single amino acid substitution was introduced within the binding domain of the viral spike protein recognizing angiotensin converting enzyme 2 ACE2 which is known as a SARS CoV receptor The rat passaged virus more efficiently infected CHO cells expressing rat ACE2 than did the original isolate These results strongly indicate that host and virus factors such as advanced age and virus adaptation are critical for the development of SARS in rats The epidemic of severe acute respiratory syndrome SARS spread rapidly worldwide during the winter of 2003 to 2004 16 http www who int csr sars country en SARS associated coronavirus SARS CoV has been identified as the etiological agent of SARS 4 5 12 14 28 SARS CoV has caused pro gressive respiratory failure and death of approximately 800 individuals approximately 10 of over 8 000 patients http www who int csr sars country en Common symptoms of SARS are fever nonproductive cough myalgia and dyspnea An age of 60 years or older comorbid disease male sex high neutrophil counts and several biochemical abnormalities are associated with poor outcomes 1 3 16 27 38 Advanced age in particular is recognized as an independent correlate of ad verse outcomes and a predictor of mortality Experimental animals particularly monkeys have been in fected with SARS CoV to analyze various pathogenic aspects of SARS according to Koch s postulates and to develop animal models to evaluate potential vaccines and antiviral agents 2 5 6 7 14 17 24 30 31 34 Cats ferrets mice pigs guinea pigs hamsters chickens and rats have also been investigated for SARS CoV susceptibility 22 23 32 33 39 All these animals are susceptible to SARS CoV after intrarespiratory inocula tion and exhibit virus excretion in pharyngeal or nasal swabs histopathological pulmonary lesions and seroconversion In monkeys aged mice and Syrian hamsters infection is not lethal but results in consolidative pneumonitis that resolves within 1 week 7 24 30 32 33 34 Thus existing animal models are useful to analyze the pathology associated with early phases of SARS CoV infection and to provide insights into early events in SARS CoV infection The SARS CoV spike S protein mediates the infection of receptor bearing cells In the case of several avian and mam malian coronaviruses the S protein is cleaved by furin or a related protease into S1 and S2 proteins The S1 protein bears the receptor attachment site and the S2 protein mediates fusion activity 15 Angiotensin converting enzyme 2 ACE2 is a functional receptor for SARS CoV that binds SARS CoV S protein with a high affinity 18 19 20 Several reports suggest that ACE2 is a physiologically relevant receptor during infection Its protein expression pattern corresponds to the localization of virus infection in humans and animals 10 35 Also the efficiency of infection in humans and other species correlates with the ability of ACE2 in that species to support viral replication 18 21 Structural analysis of the peptidase domain of human palm civet mouse and rat ACE2 with the SARS CoV receptor binding domain of S1 has identified as pects of that interface that enable efficient cross species infec tion and human to human transmission 18 Interestingly rat ACE2 does not support infection by SARS CoV The objectives of this study were to understand the patho genesis of and develop an animal model for SARS We found that the Frankfurt 1 isolate of SARS CoV replicated in the respiratory tracts of F344 rats without associated clinical symp toms We passaged the Frankfurt 1 isolate serially in young F344 rats and found that by the 10th passage the virus was altered such that it replicated more efficiently in rats than did the original virus Furthermore adult rats showed more severe acute lung injury than did young rats after infection with the passaged virus Higher levels of cytokines were seen in adult Corresponding author Mailing address Department of Pathology National Institute of Infectious Diseases Gakuen 4 7 1 Musashimu rayama Tokyo 208 0011 Japan Phone 81 42 561 0771 Fax 81 42 561 6572 E mail nnagata nih go jp H17188 Published ahead of print on 6 December 2006 1848 rats than in young rats after infection Analysis of the nucleo tide sequence of passaged virus encoding relevant S1 domains identified a missense mutation in the receptor binding domain We found that this mutation is responsible for more efficient viral replication in rats Comparative analysis of immune re sponses including an elevation in cytokine levels and his topathological findings in young and adult animals is crucial for understanding SARS pathogenesis MATERIALS AND METHODS Viruses and cells The SARS CoV Frankfurt 1 isolate used here was kindly supplied by John Ziebuhr Institute of Virology and Immunology University of Wu rzburg Wu rzburg Germany Virus was propagated twice in Vero E6 cells purchased from the American Type Culture Collection Manassas VA Vero E6 cells were cultured in Eagle s minimal essential medium MEM containing 5 fetal bovine serum 50 IU of penicillin G and 50 H9262g of streptomycin per ml Titers of this stock were expressed as 50 of the tissue culture infectious dose TCID 50 which was calculated according to the Behrens Ka rber method using Vero E6 cells Work with infectious SARS CoV was performed under biosafety level 3 conditions Experimental infection of rats with SARS CoV F344 rats 4 week old females purchased from Japan SLC Inc were inoculated intranasally with SARS CoV in a volume of 100 H9262l into the left nostril under anesthesia using an intraperi toneal injection of 0 1 ml 10 g body weight of 1 00 mg of ketamine Ketalar plus 0 02 mg of xylazine Each animal was bled under ether anesthesia and sacrificed on days 3 5 7 and 21 postinoculation p i Animals were housed in biosafety level 3 animal facilities Protocols for animal experiments were approved by the Animal Care and Use Committee of the National Institute of Infectious Dis eases Tokyo Japan Serial in vivo passage of SARS CoV in rats The Frankfurt 1 isolate was serially passaged 10 times in 4 week old female F344 rats After intranasal inoculation three rats were sacrificed on day 3 p i to collect bronchoalveolar wash fluids Lungs were removed under sterile conditions washed three times and homogenized in 2 ml phosphate buffer containing 0 1 bovine serum albu min 20 IU of penicillin G 20 H9262l of streptomycin and 1 H9262g of amphotericin B per ml The wash fluid was then serially inoculated into F344 rats 10 times At the 5th and 10th passage wash fluids F ratV and F ratX respectively were checked for virulence in rats After 10 passages lung homogenates were centrifuged at 2 000 rpm for 20 min and the supernatant was used to infect Vero E6 cells Cells were infected with 1 ml of the homogenates in 10 ml of MEM containing 2 fetal bovine serum After1hofabsorption the inoculum was removed and MEM containing 2 fetal bovine serum was added Infected cell cultures were con tinuously incubated at 37 C with 5 CO 2 Cells were harvested 2 days after infection and treated once by freeze thawing After centrifugation at 2 000 rpm for 20 min the supernatant was used as the virus inoculum F ratX VeroE6 Frankfurt 1 F ratV F ratX and F ratX VeroE6 were intranasally inoculated into 4 week old female F344 rats While still under ether anesthesia the rats were bled and sacrificed by exsanguination on days 3 5 7 and 21 p i respec tively Three of the six rats were analyzed for virus replication and cytokine responses and the other three were investigated histopathologically on each day F ratX VeroE6 was similarly inoculated into adult F344 rats 7 to 8 month old males purchased from Charles River Inc Japan After intranasal inoculation with 100 H9262l of the virus three adult rats were bled under ether anesthesia and killed by exsanguination on days 3 5 and 7 p i to analyze virus replication and cytokine responses Adult rats were also used for pathological examination on days 3 5 7 14 and 21 p i Follow up experiments were performed using 200 H9262l of strain F ratX VeroE6 using adult rats for pathological examination on days 3 5 7 and 14 p i Virus isolation and titration Tissue homogenates 20 wt vol from lung or maxilla including nasal cavity were prepared in MEM containing 2 fetal bovine serum 50 IU of penicillin G 50 H9262g of streptomycin and 2 5 H9262g of amphotericin B per ml Samples were clarified by centrifugation at 2 000 rpm for 20 min and supernatants were inoculated onto VeroE6 cell cultures for virus isolation and titration Neutralizing antibody Plasma samples were diluted twofold in a range from 1 10 to 1 320 with MEM containing 2 fetal bovine serum 50 IU of penicillin G 50 H9262g of streptomycin and 2 5 H9262g of amphotericin B per ml Each sample was mixed with the same volume of MEM containing SARS CoV at an infectious dose of 100 TCID 50 per 100 H9262l and the mixture was incubated for1hat37 C for neutralization After incubation 100 H9262l of each sample was inoculated onto monolayers of Vero E6 cells in 96 well culture plates which were incubated at 37 C with 5 CO 2 After 48 h cells were examined for cytopathic effects CPEs The neutralizing antibody was determined as a reciprocal of the highest dilution at which a CPE was not observed Histopathology and immunohistochemistry Animals were anesthetized and perfused with 10 ml of 10 phosphate buffered formalin Fixed tissues of lung heart kidney liver spleen small and large intestine brain spinal cord and maxilla including nasal cavity were routinely embedded in paraffin sectioned and stained with hematoxylin and eosin Maxilla samples were decalcified in phosphate buffered saline PBS pH 7 4 plus 10 EDTA before embedding Immunohistochemical detection of the SARS CoV and ACE2 antigens was performed on paraffin embedded sections Rabbit antibodies against SARS CoV and recombinant human ACE2 R BioSource International Inc Camarillo CA for 30 min on ice with vortexing at 10 min intervals and centrifuged at 13 000 rpm for 10 min at 4 C Supernatants were diluted 1 5 in assay diluent and assayed Multiplex beads were vortexed and sonicated for 30 s and 25 H9262l was added to each well of a 96 well filter plate and washed twice with wash buffer Samples were diluted 1 2 with assay diluent and loaded onto a Millipore Multiscreen BV 96 well filter plate to which 50 H9262l of incubation buffer had been added to each well Serial dilutions of cytokine standards were prepared in parallel and added to the plate Samples were incubated on a plate shaker in the dark at room temperature for 2 h The plate was applied to a Millipore Multiscreen vacuum manifold and washed twice with 200 H9262l wash buffer and 100 H9262l of biotinylated anti rat multicytokine detector antibody was added to each well The plate was shaken again as described above for 1 h applied to a Millipore Multiscreen vacuum manifold and washed twice with 200 H9262l wash buffer One hundred microliters of streptavidin R phyco erythrin was added directly to each well and the plate was shaken again as described above for 30 min applied to the vacuum manifold and washed twice One hundred microliters of wash buffer was added to each well and the plate was shaken for 3 min The assay plate was analyzed using the Bio Plex Luminex 100 XYP instrument Cytokine concentrations were calculated using Bio Plex Man ager 3 0 software with a five parameter curve fitting algorithm applied for stan dard curve calculations Infection of rat ACE2 expressing CHO cells with in vivo passaged SARS CoV Rat ACE2 cDNA was amplified by PCR from reverse transcribed rat kidney RNA using primers mACE2f2 5H11032 TTGCTCAGTGGATGGGATCTTGGC 3H11032 and ratACE2r1 5H11032 GCATACAGTAAAATGACGACGAGTG 3H11032 and cloned into a pcDNA 3 1 H11001 vector Invitrogen Grand Island NY A variant rat ACE2 gene with amino acid residues 82 to 84 NYS altered to residues corresponding to human ACE2 MYP was generated as described previously by Li et al 20 and cloned into pcDNA 3 1 H11001 CHO cells were transfected with plasmids encoding either form Cells were infected with the Frankfurt 1 isolate or F ratX VeroE6 at a multiplicity of infection of 0 002 and culture supernatants were harvested 72 h p i for virus titration Molecular modeling of a complex of rat passaged SARS CoV spike protein and rat ACE2 To predict the three dimensional 3 D structure of the receptor binding domain of rat passaged SARS CoV spike protein complexed with rat ACE2 we used the crystal structure of the receptor binding domain of SARS CoV spike protein human ACE2 complex at a 2 9 resolution Protein Data Bank accession number 2AJF 18 as a template for homology modeling 3 D models were constructed independently by a homology modeling technique using MOE Align and MOE Homology in the Molecular Operating Environment MOE Chemical Computing Group Inc Canada as described previously 11 3 D structures were thermodynamically optimized by energy minimization using MOE and an AMBER99 force field 29 Physically unacceptable local structures of optimized 3 D models were further refined using the Ramachandran plot program packaged in MOE Statistical analysis All data were analyzed by Student s t test RESULTS Enhanced virulence of SARS CoV after serial in vivo pas sage in rats Three days after intranasal inoculation with the Frankfurt 1 isolate of SARS CoV histopathological lesions in lungs of young F344 rats 4 week old females three rats per group were mild and virus antigen positive cells were rarely seen Fig 1A During 10 serial passages of the Frankfurt 1 isolate the virus was consistently identified in the maxillar tissue including the nasal cavity lung tissue and lung fluids Fig 1B In nasal wash fluids infectious virus was not detect able after the fourth passage It has been reported that a variant of the Frankfurt 1 isolate emerged in which 45 nucleotides nucleotides 27670 to 27714 are deleted within ORF7b upon replication in cell culture 36 Thus the Frankfurt 1 isolate used in the present study was a mixture of the original virus without the deletion and a variant carrying the deletion Fig 1C A variant with the deletion in the ORF7b region was detected in nasal and lung washes of Frankfurt 1 infected rats however during serial passage in vivo that variant was not detected Fig 1C and D Replica tion and pathogenicity of the 5th and 10th serially passaged viruses referred to as F ratV and F ratX respectively in the FIG 1 Experimental infection and serial in vivo passages of SARS CoV in young F344 rats 4 week old females n H11005 3 A He matoxylin and eosin stained tissue section of lung After intranasal inoculation with the Frankfurt 1 isolate no inflammatory reaction in bronchi was observed A few virus positive cells in bronchi were seen by immunohistochemistry using SARS CoV specific antibody inset arrowheads Br bronchi Al alveoli BV blood vessel magnification H1100320 inset magnification H1100340 B Virus titers were detected in the maxilla including nasal cavity and lung tissue homogenates and lung wash fluids following 10 serial passages The detection limit was 10 1 5 TCID 50 g of tissue C DNA of serially passaged virus was amplified by RT PCR of lung wash fluids using primers specific for ORF7b encoding cDNA No ORF7b deletion mutant was replicated during the serial passage Positive indicates that the Frankfurt 1 isolate was am plified by RT PCR negative indicates that distilled water was used as a negative control D Viral DNA was amplified by RT PCR of nasal and lung wash fluids on day 3 p i using ORF7b primers A 45 nucle otide in frame deletion in ORF7b was detected in nasal and lung wash fluid from one animal animal 3 and two animals animals 1 and 2 after infection with the Frankfurt 1 isolate respectively F ratV and F ratX virus were passaged 5 and 10 times serially respectively The same positive and negative controls were used in C 1850 NAGATA ET AL J VIROL respiratory tract of young F344 rats were higher than that seen with the original Frankfurt 1 isolate Fig 2 and Table 1 Young F344 rats inoculated with the original Frankfurt 1 iso late showed neither inflammatory lesions in lung nor virus antigen positive cells in the nasal cavity on day 3 p i Fig 2A and F After intranasal inoculation with F ratV virus antigens were observed immunohistochemically in the respiratory epi thelia of the trachea bronchi and nasal cavity which was accompanied by slight inflammatory reactions on day 3 p i Fig 2B C and G More virus antigen positive cells were seen in respiratory epithelia including the alveolar area of strain F ratX inoculated rats than in Frankfurt 1 or F ratV inocu lated rats along with severe inflammatory reactions Fig 2D E and H Inflammatory reactions including neutrophils mac rophages and lymphocytes as well as microhemorrhage were seen on day 5 p i Fig 2D and E Thus serial in vivo passage of virus in young rats increased SARS CoV virulence None of young F344 rats inoculated with the Frankfurt 1 isolate F ratV or F ratX showed any obvious clinical signs and they survived until the observation period Increased pathogenicity of serially passaged SARS CoV in adult rats In humans advanced age is associated with greater mortality in SARS patients Thus we analyzed potential dif ferences in clinical and pathological features following infec tion of young 4 week old females and adult 7 to 8 month old males rats with F ratX Since quantities of the F ratX FIG 2 Histopathologies of lung A to E and nasal cavity F to H in young F344 rats 4 week old females n H11005 3 after intranasal inoculation with serially passaged virus Br bronchi Al alveoli NC nasal cavity A No inflammatory infiltrates in lung after inoculation with the Frankfurt 1 isolate were observed on day 3 p i hematoxylin and eosin staining magnification H1100310 B and C Slight inflammatory reactions around bronchioles were observed in F344 rats after intranasal inoculation with five times serially passaged Frankfurt 1 strain F ratV on day 3 p i C Extensive cellular debris in bronchioles comprised of necrotic epithelia and inflammatory cells magnification H1100350 Immunohistochemical staining using SARS CoV specific antibody detected virus antigen positive cells in bronchioles and epithelial cells C inset immunohistochem istry magnification H11003100 D and E Expanded inflammatory reactions around bronchioles and the alveolar area were observed in F344 rats after inoculation with 10 times serially passaged Frankfurt 1 strain F ratX on day 5 magnifications H1100310 D H1100350 E and H11003100 inset p i Small hemorrhages H11569 and