【病毒外文文献】2006 Glycosylation of the Severe Acute Respiratory Syndrome Coronavirus Triple-Spanning Membrane Proteins 3a and M

JOURNAL OF VIROLOGY Mar 2006 p 2326 2336 Vol 80 No 5 0022 538X 06 08 00H110010 doi 10 1128 JVI 80 5 2326 2336 2006 Copyright 2006 American Society for Microbiology All Rights Reserved Glycosylation of the Severe Acute Respiratory Syndrome Coronavirus Triple Spanning Membrane Proteins 3a and M M Oostra C A M de Haan R J de Groot and P J M Rottier Virology Division Department of Infectious Diseases and Immunology Utrecht University 3584 CL Utrecht The Netherlands Received 6 September 2005 Accepted 8 December 2005 The severe acute respiratory syndrome coronavirus SARS CoV open reading frame 3a protein has recently been shown to be a structural protein The protein is encoded by one of the so called group specific genes and has no sequence homology with any of the known structural or group specific proteins of coronaviruses It does however have several similarities to the coronavirus M proteins i they are triple membrane spanning with the same topology ii they have similar intracellular localizations predominantly Golgi iii both are viral structural proteins and iv they appear to interact with the E and S proteins as well as with each other The M protein plays a crucial role in coronavirus assembly and is glycosylated in all coronaviruses either by N linked or by O linked oligosaccharides The conserved glycosylation of the coronavirus M proteins and the resemblance of the 3a protein to them led us to investigate the glycosylation of these two SARS CoV membrane proteins The proteins were expressed separately using the vaccinia virus T7 expression system followed by metabolic labeling Pulse chase analysis showed that both proteins were modified although in different ways While the M protein acquired cotranslationally oligosaccharides that could be removed by PNGaseF the 3a protein acquired its modifications posttranslationally and they were not sensitive to theN glycosidase enzyme The SARS CoV 3a protein however was demonstrated to contain sialic acids indicating the presence of oligosaccharides O glycosylation of the 3a protein was indeed confirmed using an in situ O glycosylation assay of endoplasmic reticulum retained mutants In addition we showed that substitution of serine and threonine residues in the ectodomain of the 3a protein abolished the addition of the O linked sugars Thus the SARS CoV 3a protein is an O glycosylated glycoprotein like the group 2 coronavirus M proteins but unlike the SARS CoV M protein which is N glycosylated Severe acute respiratory syndrome SARS recently emerged as a new human disease It originated in southern China at the end of 2002 and spread to various areas all over the world affecting more than 8 000 people worldwide and killing more than 800 The causative agent of the disease was rapidly iden tified and found to be a novel coronavirus called SARS coro navirus SARS CoV 13 28 39 Until then only two human coronaviruses HCoV were known 229E and OC43 both causing common colds Since the SARS outbreak two new human coronaviruses have been identified HCoV NL63 16 58 and HCoV HKU1 64 both causing potentially severe respiratory infections The approximately 30 kb positive strand RNA of the SARS CoV fully sequenced within months after the outbreak 34 40 appeared to have a genomic composition somewhat dif ferent from those of all known coronaviruses All the typical coronaviral genes were readily identified among the 14 poten tial open reading frames ORFs The 5H11032 two thirds of the genome is occupied by ORFs 1a and 1b which encode the proteins involved in RNA replication and transcription Down stream of these are the ORFs that encode the four structural proteins the spike S glycoprotein the membrane M pro tein the envelope E protein and the nucleocapsid N pro tein However an unusually high number eight of so called group specific genes were found interspersed between the genes in the 3H11032 part of the genome By their number nature and location the group specific genes differ greatly from those of other coronaviruses placing the SARS CoV in a distinct taxonomic position 34 40 50 The group specific genes have so far appeared not to be essential for the replication of coronaviruses at least in cell culture They are however of key importance for virus host interactions contributing critically to viral virulence and patho genesis Deletion of some or all of the group specific genes was shown to be attenuating in the natural host for the murine hep atitis virus MHV 8 transmissible gastroenteritis virus 38 and feline infectious peritonitis virus 20 The SARS CoV con tains eight group specific genes two occurring between the S and E genes ORFs 3a and 3b five between the M and N genes ORFs 6 7a 7b 8a and 8b and one within the N gene ORF 9b For two of these ORFs 3a and 7a expression during SARS CoV infection has been demonstrated 53 65 66 With 274 amino acids the 3a protein is the largest of the group specific gene products Antibodies against this protein were found in sera from convalescent SARS patients and ex perimentally infected animals 19 52 65 Hydrophobicity analysis predicts the occurrence of three transmembrane do mains within the 3a protein http www cbs dtu dk services TMHMM The protein was shown to have an N terminal ectodomain and a C terminal endodomain 53 suggesting a membrane structure quite similar to that of the coronaviral M protein This similarity also holds in part for the intracellular localization as the 3a protein was found to localize in the Golgi compartment and at the cell surface from which it is endocy tosed 53 65 The M proteins of different coronaviruses are Corresponding author Mailing address Virology Division De partment of Infectious Diseases and Immunology Utrecht University 3584 CL Utrecht The Netherlands Phone 31 30 253 2462 Fax 31 30 253 6723 E mail p j m rottier vet uu nl 2326 also primarily localized in the Golgi compartment 23 33 45 close to the site where coronavirus assembly takes place i e in the endoplasmic reticulum ER Golgi intermediate compart ment 27 54 56 Considering all these similarities to the M protein the SARS CoV 3a protein appeared to be a potential structural protein which it was in fact recently demonstrated to be 26 49 The M proteins of all known coronaviruses are glycosylated N linked glycosylation and O linked glycosylation both occur The M proteins of group 1 and 3 coronaviruses represented by trans missible gastroenteritis virus and infectious bronchitis virus re spectively are only N glycosylated i e they carry their oligosac charide side chains through N linkage to asparagine residues In contrast M proteins of the group 2 coronaviruses with MHV as the prototype are only O glycosylated thus having their side chains attached by O linkage to hydroxyl groups of serine and threonine residues 9 24 37 43 44 Many different functions have been assigned to oligosaccharide side chains The carbohy drates have been shown to be important for folding structure stability and intracellular sorting of proteins and to play a role in the generation of immune responses 12 21 48 57 Glycosyla tion of viral glycoproteins in particular has been shown to be important for the generation of their bioactive conformation and can have effects on receptor binding fusion activity and antigenic properties of the virus 1 4 6 62 In the present study the glycosylation status of the SARS CoV M and 3a proteins was examined The SARS CoV M protein is predicted to be N glycosylated For the 3a protein the glycosylation state is of particular interest due to the pro tein s structural nature its structural similarities to the M pro tein and its apparent but unidentified modification s as ob served in published work 26 49 53 65 66 The protein contains an N glycosylation consensus sequence in its amino terminal ectodomain By using a number of approaches it was established that the two proteins are indeed both glycosylated but differently MATERIALS AND METHODS Cells viruses and antibodies Ost 7 cells obtained from B Moss 14 were maintained as monolayer cultures in Dulbecco s modified Eagle s medium Cam brex Bio Science Verviers Belgium containing 10 fetal calf serum Bodinco B V 100 IU of penicillin and 100 H9262g of streptomycin per ml Recombinant vaccinia virus encoding the bacteriophage T7 RNA polymerase vTF7 3 was obtained from B Moss 17 The polyclonal rabbit antisera directed against the SARS CoV M and 3a proteins were obtained from Y J Tan 53 and the polyclonal rabbit MHV A59 antiserum K134 was described earlier 44 Plasmid constructions All expression vectors contained the genes under con trol of bacteriophage T7 transcription regulatory elements and all SARS CoV sequences were from isolate 5688 29 Expression construct pTugM s contains the SARS CoV M gene cloned in plasmid pTUG31 The SARS CoV M gene was amplified by PCR from a construct containing the 3H11032 end genomic cDNA of the SARS CoV with primers 2054 5H11032 CGAATTCGCCGCCATGGCAG ACAACGGTACTA 3H11032 corresponding to nucleotides 26398 to 26416 of the SARS CoV and 2057 5H11032 CGGGATCCTTACTGTACTAGCAAAGC 3H11032 cor responding to nucleotides 27063 to 27046 of the SARS CoV Both primers contain a 5H11032 extension introducing EcoRI and BamHI restriction enzyme recog nition sites underlined The PCR product was digested with EcoRI and BamHI and ligated into the EcoRI BamHI digested pTUG31 vector The nucleotide sequence of the PCR product was confirmed by sequencing Expression construct pTug3a contains the SARS CoV strain 5688 3a gene cloned in pTUG31 The SARS CoV 3a gene was amplified by PCR with primers 2161 5H11032 CGAGATCTACCATGGATTTGTTTATGAGA 3H11032 corresponding to nucleotides 25268 to 25286 of the SARS CoV and 2162 5H11032 CGAGATCTGA ATTCTTACAAGGCACGCTAGT 3H11032 corresponding to nucleotides 26092 to 26074 of the SARS CoV Both primers contain a 5H11032 extension introducing a BglII restriction enzyme recognition site underlined The PCR product was digested with BglII and ligated into the BamHI digested pTUG31 vector The nucleotide sequence of the PCR product was confirmed by sequencing A mutant SARS CoV 3a gene encoding a 3a protein with an ER retention signal in its carboxyl terminus was made by PCR mutagenesis using primers 2161 and 2416 5H11032 AGATCTTAGGCTGTCTTCTTCAAAGGCACGCTAGTAGT 3H11032 corresponding to nucleotides 26089 to 26072 of the SARS CoV containing a BglII site underlined and the desired mutation italics The resulting mutant 3a gene 3aKK was transferred as a BglII fragment into the BamHI site of expression vector pTUG31 and designated pTug3aKK The pTugM m and pTugM m KK expression vectors have been described previ ously 9 45 and were used for the generation of the SARS CoV 3a MHV M hybrid expression vectors The region encoding the SARS CoV 3a ectodomain was amplified by PCR with primer 2454 5H11032 CGCTCGAGACCATGGATTTG TTTATGAGA 3H11032 corresponding to nucleotides 25268 to 25286 of the SARS CoV containing an XhoI site underlined and primer 2455 5H11032 TGCTTAAG GAAAGGGAGTGAGGCT 3H11032 corresponding to nucleotides 25397 to 25382 of the SARS CoV containing an AflII site The PCR fragment was digested with XhoI and AflII and cloned into the pTugM m and pTugM m KK vectors that had been treated with the same enzymes creating pTug3aM m and pTug3aM m KK respectively The generation of the expression vectors for the ER retained GalNAc transferases and sialyltransferase have been described previously 9 41 Mutations of the potential glycosylation sites in the SARS CoV 3a ectodomain were introduced by PCR based site directed mutagenesis Fragment 1 was am plified by PCR with primers 2454 and 2574 5H11032 GCGGCCGCATGAACAGCA CCTG 3H11032 corresponding to nucleotides 25365 to 25344 of the SARS CoV containing a NotI site underlined created by the mutations shown in boldface while fragment 2 was amplified by PCR with primer 2573 5H11032 TTCATGCGGCC GCAGCGATA 3H11032 corresponding to nucleotides 25353 to 25372 of the SARS CoV containing a NotI site underlined created by the mutation shown in boldface and primer 2162 containing an EcoRI site The PCR fragments were digested with NotI and either XhoI or EcoRI and cloned by three point ligation into the XhoI and EcoRI digested pTUG31 vector creating pTug3a GAAA The sequences of mutated PCR products were confirmed by sequencing Infection and transfection Subconfluent monolayers of Ost 7 cells grown in 10 cm 2 tissue culture dishes were inoculated with vTF7 3 at a multiplicity of infection of 10 for 1 h after which the medium was replaced by transfection mixture consisting of 0 5 ml of Dulbecco s modified Eagle s medium without fetal calf serum but containing 10 H9262l of Lipofectin Life Technologies and 5 H9262g of each selected construct After a 5 min incubation at room temperature 0 5 ml of Dulbecco s modified Eagle s medium was added and incubation was continued at 37 C Three hours after infection the medium was replaced by culture me dium and where indicated tunicamycin 5 H9262g ml or brefeldin A 6 H9262g ml was added to the medium Metabolic labeling and immunoprecipitation At 4 5 h postinfection p i the cells were starved for 30 min in cysteine and methionine free modified Eagle s medium containing 10 mM HEPES pH 7 2 and 5 dialyzed fetal calf serum The medium was then replaced by 1 ml of similar medium containing 100 H9262Ci of 35 S in vitro cell labeling mixture Amersham after which the cells were further incubated for the indicated time periods When pulse chase experiments were carried out after the labeling period the cells were washed once with culture medium containing 2 mM each of unlabeled methionine and cysteine and incu bated further in the same medium After the labeling or the chase the cells were washed once with phosphate buffered saline PBS containing 50 mM Ca 2H11001 and 50 mM Mg 2H11001 and then lysed on ice in 1 ml of lysis buffer 0 5 mM Tris pH 7 3 1 mM EDTA 0 1 M NaCl 1 Triton X 100 per 10 cm 2 dish The lysates were cleared by centrifugation for 5 min at 15 000 rpm and 4 C Radioimmunoprecipitation was performed on 150 or 200 H9262l aliquots of ly sates diluted to 1 ml with detergent buffer 50 mM Tris pH 8 0 62 5 mM EDTA 1 NP 40 0 4 sodium deoxycholate NaDOC 0 1 sodium dodecyl sulfate SDS and antibodies 2 H9262l of rabbit anti MHV serum K134 or rabbit anti SARS CoV M serum or 1 H9262l of rabbit anti SARS CoV 3a serum The precipitation reaction mixtures were incubated overnight at 4 C The immune complexes were adsorbed to Pansorbin cells Calbiochem for 60 min at 4 C and were subsequently collected by centrifugation The pellets were washed three times by resuspension and centrifugation using RIPA buffer 10 mM Tris pH 7 4 150 mM NaCl 0 1 SDS 1 NP 40 1 NaDOC The final pellets were suspended in Laemmli sample buffer LSB and heated at 95 C for 5 min for the SARS CoV 3a proteins and 1 min for the M and hybrid proteins before analysis by SDS polyacrylamide gel electrophoresis PAGE using a 15 polyacrylamide gel VOL 80 2006 GLYCOSYLATION OF SARS CoV 3a AND M PROTEINS 2327 Some immunoprecipitates were treated with peptide N glycosidase F PNGaseF New England Biolabs neuraminidase arthrobacter Roche Applied Science or O glycosidase Roche Applied Science In those cases the final precipitation pellets were suspended in PBS instead of LSB and heated at 95 C after which 2 H9262l PNGaseF 2 H9262l neuraminidase or 4 H9262l O glycosidase was added and the samples were incubated overnight at 37 C or 2 H9262l neuraminidase was added and the samples were incubated at 37 C for 3 h after which 4 H9262l O glycosidase was added and the mixture was further incubated overnight at 37 C Before analysis by SDS PAGE 0 5 volume of a three times concentrated solution of LSB was added to the samples Immunofluorescence microscopy Ost 7 cells grown on 10 mm glass coverslips were infected with vTF7 3 at a multiplicity of infection of 10 and transfected with the different constructs Then 5 mM hydroxyurea Sigma Aldrich was added to the medium to limit the cytopathic effect of the vaccinia virus infection At 6 h p i the cells were either fixed or 5 mM cycloheximide Sigma Aldrich was added to the medium and the cells were fixed 1 h later Fixation was carried out by first washing the cells once with PBS containing 50 mM Ca 2H11001 and 50 mM Mg 2H11001 and then incubating them with ice cold methanol at H1100220 C for 10 min The fixed cells were washed twice with PBS and incubated for 15 min in blocking buffer PBS 10 normal goat serum followed by a 45 min incubation with SARS CoV 3a antiserum diluted 1 500 in blocking buffer MHV antiserum K134 diluted 1 400 in blocking buffer or mouse monoclonal anti p58 antibody Sigma Aldrich diluted 1 50 in blocking buffer After three washes with PBS 0 05 Tween 20 the cells were stained for 45 min with fluorescein isothiocya nate conjugated goat anti rabbit immunoglobulin G antibodies ICN diluted 1 150 in blocking buffer or with Cy5 conjugated donkey anti mouse immuno globulin G antibodies Jackson Laboratories diluted 1 200 in blocking buffer Following three washes with PBS 0 05 Tween 20 and one with PBS the sam ples were mounted on glass slides in FluorSave Calbiochem The samples were examined with a confocal fluorescence microscope Leica TCS SP2 RESULTS Co and posttranslational modifications of the SARS CoV M and 3a proteins To investigate whether the SARS CoV 3a protein undergoes a posttranslational modification a classical pulse chase analysis was performed after the gene was ex pressed using the vaccinia virus vTF7 3 expression system Ost 7 cells were infected with vTF7 3 transfected with the 3a gene containing plasmid pulse labeled with 35 S methionine and 35 S cysteine for 15 min starting at 4 5 h p i and chased for 0 1 or 3 h followed by lysis of the cells and immunoprecipi tation with a rabbit peptide antiserum directed to the endodo main residues 134 to 274 of the 3a protein As shown in Fig 1A left the pulse labeled product appeared as an ap proximately 31 kDa protein which corresponds to the pre dicted size of the unmodified 3a protein After1hofchase the protein had been converted almost completely into a slower migrating form which had become even more prominent after 3 h of chase during which time no additional forms had ap peared This slower migrating form has an apparent molecular mass about 2 kDa larger than that of the unmodified 3a pro tein The results indicate that the SARS CoV 3a protein is modified posttranslationally To study the nature of the observed modification further the 3a protein was expressed similarly but in the presence of tunica mycin a drug known to prevent N glycosylation The SARS CoV M protein predicted to be N glycosylated was also included in the experiment After the labeling the proteins were analyzed as before except that the immunoprecipitation of the M protein was performed with a rabbit peptide antiserum against the endodo main of this protein As the autoradiograph in Fig 1A right shows the M protein synthesized in the absence of tunicamycin appeared as two species after pulse labeling the slowest migrat ing of which had disappeared during the chase probably resulting from the extensive posttranslational modifications of the N gly cans in the Golgi compartment which make the protein appear as a smear higher in the gel rather than a clear band In the presence of the drug the slowest migrating species had not been formed either during the pulse or after the chase These observations indicate that the SARS CoV M protein is cotranslationally mod ified though incompletely while the sensitivity to tunicamycin indicates that the modification indeed involves N glycosylation Tunicamycin however did not affect the modification of the SARS CoV 3a protein The same protein patterns appeared as in the absence of the compound Fig 1A left Apparently the SARS CoV 3a protein is not modified by N glycosylation Further support for these conclusions was sought by study ing the sensitivities of the modifications to PNGaseF an en zyme able to speci