【病毒外文文献】2006 False-Positive Results in a Recombinant Severe Acute Respiratory Syndrome-Associated Coronavirus (SARS-CoV) Nucleoc

CLINICAL AND VACCINE IMMUNOLOGY Mar 2006 p 409 414 Vol 13 No 3 1556 6811 06 08 00H110010 doi 10 1128 CVI 13 3 409 414 2006 Copyright 2006 American Society for Microbiology All Rights Reserved False Positive Results in a Recombinant Severe Acute Respiratory Syndrome Associated Coronavirus SARS CoV Nucleocapsid Based Western Blot Assay Were Rectified by the Use of Two Subunits S1 and S2 of Spike for Detection of Antibody to SARS CoV Mimoun Maache 1 Florence Komurian Pradel 1 Alain Rajoharison 1 Magali Perret 1 Jean Luc Berland 1 Ste phane Pouzol 1 Audrey Bagnaud 1 Blandine Duverger 1 Jianguo Xu 2 Antonio Osuna 3 and Glaucia Paranhos Baccala 1 Emerging Pathogens Department of bioMe rieux IFR128 BioSciences Lyon Gerland CERVI 21 Avenue Tony Garnier 69365 Lyon Cedex 07 France 1 State Key Laboratory for Infectious Disease Prevention and Control China CDC National Institute for Communicable Disease Control and Prevention Changping Beijing 100026 China 2 and Biotechnology Institute University of Granada Cp 18071 Granada Spain 3 Received 20 September 2005 Returned for modification 31 October 2005 Accepted 27 December 2005 To evaluate the reactivity of the recombinant proteins expressed in Escherichia coli strain BL21 DE3 a Western blot assay was performed by using a panel of 78 serum samples obtained respectively from conva lescent phase patients infected with severe acute respiratory syndrome associated coronavirus SARS CoV 30 samples and from healthy donors 48 samples As antigen for detection of SARS CoV the nucleocapsid protein N showed high sensitivity and strong reactivity with all samples from SARS CoV patients and cross reacted with all serum samples from healthy subjects with either those obtained from China 10 samples or those obtained from France 38 serum samples giving then a significant rate of false positives Specifically our data indicated that the two subunits S1 residues 14 to 760 and S2 residues 761 to 1190 resulted from the divided spike reacted with all samples from SARS CoV patients and without any cross reactivity with any of the healthy serum samples Consequently these data revealed the nonspecific nature of N protein in serodiagnosis of SARS CoV compared with the S1 and S2 where the specificity is of 100 Moreover the reported results indicated that the use of one single protein as a detection antigen of SARS CoV infection may lead to false positive diagnosis These may be rectified by using more than one protein for the serodiagnosis of SARS CoV The severe acute respiratory syndrome SARS is a viral infectious disease caused by the human SARS associated corona virus SARS CoV 5 17 20 The SARS CoV is an enveloped positive stranded RNA vi rus with a genome of about 29 740 kb in length 2 9 Its genomic organization is typical of that of coronaviruses but the phylogenetic analysis and sequence comparison show that SARS CoV is not closely related to any of the previously char acterized coronaviruses with only an approximate 25 to 30 identity 23 In addition to the nonstructural proteins the SARS CoV genome encodes four structural proteins enve lope membrane glycoprotein nucleocapsid N and spike S 19 Each of these proteins plays a key role in the virus infection cycle and pathogenicity especially the two major structural proteins such as nucleocapsid and spike proteins 7 13 14 15 Spike a major structural glycoprotein of coronaviruses is cleaved for many of them into two noncovalently associated subunits S1 and S2 15 The distal subunit S1 contains the receptor binding domain which interacts with a cellular recep tor ACE2 angiotensin I converting enzyme 2 and the mem brane anchored subunit S2 contains a putative internal fusion peptide inducing membrane fusion to allow viral entry into a susceptible target cell However this phenomenon of cleavage is not yet clear for the spike of SARS CoV 10 15 The S protein is a main surface antigen a factor of virulence and a major neutralizing antigen capable of inducing protective im munity and eliciting immune responses during viral infection 3 9 10 12 24 33 34 For the known coronaviruses the spike protein is recognized by antibodies to SARS CoV and it is considered one of the candidate antigens for the detection of SARS CoV owing to its high antigenicity 11 The nucleocapsid protein appears to be the more conserved antigen among other viral structural proteins 6 36 and is involved in important functions such as the formation of he lical nucleocapsid during the viral life cycle and it has also been reported to activate the AP1 activator protein1 signal transduction pathway 26 In addition to its physiological and structural roles the nucleocapsid protein appears to be the major immunogenic antigen Nucleocapsid protein is abun dantly expressed during viral infection and is readily recog nized by acute phase sera from SARS patients and by T cells on the infected cell surface 4 21 25 37 In addition the involvement of N protein in the generation of primary humoral immune response was suggested 1 28 Antigenicity studies in other coronaviruses indicated that the N protein is one of the immunodominant antigens that Corresponding author Mailing address Emerging Pathogens De partment of bioMe rieux CERVI 21 Avenue Tony Garnier 69365 cedex 07 Lyon France Phone 33 04 37 28 24 13 Fax 33 04 37 28 24 11 E mail mmaache ugr es 409 on July 10 2015 by UNIVERSITY OF ARIZONA LIBRARY http cvi asm org Downloaded from induce cross reactive antibodies in high titers whereas the S glycoprotein induces the serotype specific and cross reactive antibodies 21 25 Early detection and identification of SARS CoV infected patients is absolutely critical to prevent another SARS CoV outbreak and the spread of SARS However the choice of a suitable system for the epidemiological study may allow an effective survey and control of the already infected and conva lescent phase patients In this study and by using Western blot assays our results revealed that the S1 and S2 subunits of spike protein reacted only with confirmed positive serum samples and without any cross reactivity with any of the healthy donors which indicated that the S1 and S2 proteins are specific anti gens for the diagnosis of SARS CoV The nucleocapsid protein has been reported to be a sensitive marker for the serodiag nosis of SARS CoV 8 However our results while confirm ing its high sensitivity also showed the nonspecific nature of this protein and indicated that the N protein reacted strongly to all healthy serum samples giving a significant rate of false positives In addition the use of one single antigen for the detection or diagnosis of SARS CoV gives limited information and might lead to false positive results Therefore this study provides very useful information for choosing a suitable anti gen system for the serodiagnosis of SARS CoV infection MATERIALS AND METHODS RNA extraction RNA extraction was performed in a biosafety level 3 labora tory RNA was extracted directly from plasma samples according to the manu facturer s instructions by using the miniMAG viral RNA mini kit NucliSens bioMe rieux Boxtel The Netherlands Constructions of plasmids for expression of S1 S2 and N genes of SARS CoV i Spike protein After computer analysis to predict and delete hydrophobic regions hydrophobic cluster analysis the spike protein of SARS CoV urbani strain was divided into the S1 residues 14 to 760 and S2 residues 761 to 1190 subunits because the complete protein could not be well expressed in Escherichia coli strain BL21 DE3 Novagen Merck Eurolab Fontenay Sous Bois France By using reverse transcription and PCR Invitrogen Cergy Pontoise France with a specific pair of primers Table 1 the genes encoding the S1 and S2 proteins were amplified Both expected fragments coding for S1 and S2 were digested with XbaI BamHI and separately cloned into the expression plasmid pET21b opened with the same restriction enzymes to generate the expression vectors pET21b S1 and pET21b S2 ii Nucleocapsid protein The complete gene coding for N protein was am plified by using reverse transcription PCR Invitrogen Cergy Pontoise France and specific primers Table 1 After being digested with XbaI BamHI the PCR product coding for the N protein was inserted into the expression vector digested with the same enzymes to generate the expression vector pET21b N The three inserts coding for the three proteins were sequenced to confirm the exactness of the S1 S2 and N protein sequences and proper in frame ligation In addition all proteins were expressed as C terminal His 6 tag proteins to facilitate their purification by using Ni 2H11001 nitrilotriacetic acid NTA agarose resin QIAGEN S A Courtaboeuf France Expression and purification of recombinant S1 S2 and N proteins The three expression vectors pET21b S1 pET21b S2 and pET21b N were separately transformed into Escherichia coli strain BL21 DE3 Novagen Merck Eurolab Fontenay Sous Bois France The transformed BL21 DE3 host cells were incubated for 6 to8hat37 C in 4 ml of Luria Bertani LB medium broth bioMe rieux Lyon France containing 100 H9262g ml of ampicillin Roche Diagnos tics Meylan France as an antibiotic The cultures were then diluted 1 25 vol vol in LB medium and incubated overnight at 37 C under agitation 225 rpm After overnight growth the cultures were diluted with LB medium 1 50 vol vol and after being shaken the cells grew to an optical density at 600 nm of 0 6 to 0 8 For expression IPTG isopropyl H9252 D thiogalactopyranoside was added to a final concentration of 1 mM and then the bacteria were incubated at 37 C at 250 rpm for an additional 4 to 5 h followed by centrifugation at 3 200 H11003 g for 15 min to get the cell pellets The pellets were suspended separately in 10 ml of 20 mM Tris HCl buffer pH 7 4 containing 200 mM NaCl 100 mM PMSF paramethyl sulfonyl fluoride 1 mM Benzonase and 5 mM H9252 mercaptoethanol and lysed by sonication with an ultrasonic processor Mi sonix Inc Farming dale N Y The resulting lysates were centrifuged at 10 400 H11003 g for 13 min at 4 C In addition the pellets and the supernatants were analyzed by 12 SDS PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis All three recombinant proteins expressed in E coli BL21 DE3 mainly formed inclusion bodies and released limited soluble forms in the cytoplasm Consequently the recombinant proteins could not be purified directly from the soluble fractions To obtain a high protein yield and to facilitate their purification the bacterial pellets were treated separately with 50 mM sodium phosphate buffer pH 8 0 containing 300 mM NaCl 5 mM H9252 mercaptoethanol and 8 M urea for S1 and N and 6 M guanidine for S2 followed by a strong probe sonication to completely dissolve the inclusion bodies After centrifugation at 10 400 H11003g for 13 min at 4 C the supernatants were applied separately to Ni 2H11001 NTA resin equilibrated with 5 volumes 5 ml ml of binding buffer 50 mM Na 2 HPO 4 NaH 2 PO 4 300 mM NaCl 1 mM PMSF 5 mM H9252 mercaptoethanol and 8 M urea pH 8 0 at room temperature For the three proteins the columns were then washed successively with 10 volumes of binding buffer containing 20 mM imidazole In the case of the polyhistidine tagged S1 and S2 proteins the elution was finally performed with 20 mM Tris HCl pH 7 4 containing 100 mM imidazol 300 mM NaCl and 1 mM PMSF However the tagged N protein was eluted with sodium phosphate buffer pH 4 0 containing 8 M urea To eliminate imidazole the eluates were dialyzed overnight against 50 mM sodium phosphate buffer pH 8 0 The high purity of purified proteins was analyzed by SDS PAGE and confirmed by West ern blot assay Verification of the expressed and purified S1 S2 and N proteins by using SDS PAGE and Western blot analysis The Western blot analysis was performed to verify the protein expressions and antigenicity and principally to test the sensitivity of the purified recombinant S1 S2 and N proteins to the human convalescent phase serum samples with SARS CoV The recombinant proteins were separated by 12 SDS PAGE and the protein bands were then trans ferred electrophoretically to nitrocellulose membranes Whatman Gerber shausen Germany The membranes were subsequently blocked in blocking buffer phosphate buffered saline pH 7 4 0 1 Tween 20 and 5 skim milk and probed at room temperature for 1 h with rabbit anti SARS CoV polyclonal antibody or with anti His tagged monoclonal antibody raised in mouse After being rinsed for 20 min in phosphate buffered saline containing 0 05 Tween 20 the bound antibodies were detected either with anti rabbit or with anti mouse immunoglobulin G IgG conjugated with alkaline phosphatase at a dilution of TABLE 1 Primers used for amplification of genes coding for S1 S2 and N recombinant proteins Gene Residues Primers 5H11032 3H11032 a Cloning sites S1 14 760 TCTCTCTCTAGAATGGACCTTGACCGGAGCACCAC XbaI CTCTCTGGATCCTTAGTGGTGATGGTGATGGTGAGAACCCCTCATTGT GTTGCGATCCTGTTCAGCAATACC BamHI S2 761 1190 TCTCTCTCTAGAATGCGTGAAGTGTTCGCTCAAGTC XbaI TCTCTCGGATCCTTAGTGGTGATGGTGATGGTGAGAACCCCTCATTTG CTCATATTTTCCCAATTCTTG BamHI N 1 1305 TCTCTCTCTAGAATGTCTGATAATGGACCCCAATCAAACCAACGTAGTGC XbaI CTCTCTGGATCCTTAGTGGTGATGGTGATGGTGAGAACCCCTCATTGC CTGAGTTGAATCAGCAGAAGCTCCA BamHI a Boldface type indicates restriction enzyme sites 410 MAACHE ET AL CLIN VACCINE IMMUNOL on July 10 2015 by UNIVERSITY OF ARIZONA LIBRARY http cvi asm org Downloaded from 1 10 000 The immunoprecipitated bands were developed by using a substrate mixture of O dianisidine tetrazotized and beta naphthyl acid phosphate Sigma Aldrich Lyon France in borate buffer pH 9 5 or with horseradish peroxidase conjugated secondary antibody Sigma Aldrich Lyon France followed by chemiluminescence reagents Amersham Biosciences Europe GmbH Orsay France and exposed to X ray film for 1 to 3 min To test the serum reactivities the Western blot assay was performed in a biosafety level 3 laboratory by using the purified His 6 tagged recombinant S1 S2 and N proteins After being loaded separately into each continuous well of 12 SDS PAGE the purified recombi nant proteins were electroblotted onto a nitrocellulose membrane The blot was cut into strips and the strips were incubated separately with each of 78 serum samples diluted 1 1 500 for 5 h The incubation with peroxidase conjugated secondary anti human antibody 1 10 000 and the strips revelation were per formed by following the protocol detailed above Specimens and patients A panel of 78 serum samples was used in a Western blot assay This panel includes 30 convalescent phase serum samples from Bei jing and inner Mongolia collected 20 to 25 days after disease onset obtained from the Chinese Center of Disease Control and Prevention Beijing China and confirmed for SARS CoV infection clinically by the World Health Organization criteria World Health Organization case definition of surveillance of severe acute respiratory syndrome http www who int CSR SARS casedefinition en and 10 serum samples obtained from healthy Chinese donors provided by the same center In addition another 38 negative serum samples were purchased from EFS Etablissement franc ais du sang Lyon France corresponding to healthy French donors and collected 2 years before the outbreak of SARS Rabbit anti SARS CoV polyclonal antibodies were prepared by immunizing rabbits with the SARS CoV and were kindly provided by Sanofi Pasteur Marcy l Etoile Lyon France All serum samples were stored at H1100280 C until use RESULTS Expression and purification of recombinant S1 S2 and N proteins SDS PAGE analysis of cell extracts from strains pro ducing recombinant S1 S2 and N proteins revealed that the three proteins were successfully and abundantly expressed af ter IPTG addition The size of each protein approximately corresponds to the predicted molecular mass which were de termined to be about 74 kDa 47 kDa and 49 kDa for the S1 S2 and N proteins respectively Fig 1A B and C The expression of recombinant S1 S2 and N proteins was con firmed by a Western blot analysis showing a positive reaction against monoclonal antihistidine antibody at the level of the expected molecular mass Fig 2A By using Ni 2H11001 NTA resin the recombinant polyhistidine tagged proteins were success fully purified and as expected the SDS PAGE analysis showed that each single pure band corresponded to the predicted size of the S1 S2 and N proteins Fig 2B Antigenicity analyses of purified proteins were performed and confirmed by Western blot assay against SARS CoV polyclonal antibodies raised in rabbits as shown in Fig 2C where the recombinant proteins reacted strongly According to our finding different recombi nant SARS CoV proteins may be used for the diagnostic test of SARS CoV infection However the effectiveness of each protein depends on its specificity Western blot performance of recombinant purified S1 S2 and N proteins against SARS CoV and healthy serum The analysis of 78 serum samples by Western blot Table 2 showed that almost all convalescent phase specimens with SARS CoV developed antibodies against the purified recombinant S1 S2 and N proteins However the degree of reactivity varied ac cording to the antigen and the serum sample The results revealed that the S1 protein showed strong immunoreactivity H11001H11001H11001 with 21 of 30 serum samples mod erate immunoreactivity H11001H11001 with 4 of 30 samples and weak immunoreactivity H11001 with 5 of 30 samples In addition no signal H11002 was observed with any negative serum samples from healthy donors neither with those obtained from China 10 serum samples nor with those obtained from France 38 se rum samples specificity of 100 The S2 protein showed strong reactivity H11001H11001H11001 with 16 of 30 samples moderate re activity H11001H11001 with 6 of 30 samples weak reactivity H11001 with 4 of 30 samples no signal H11002 with 4 of 30 samples sensitivity of FIG 1 Expression of the SARS CoV S1 S2 and N recombinant proteins SDS PAGE and Coomassie blue staining of the expressed SARS CoV S1 S2 and N recombinant proteins in E coli BL21 DE3 after the IPTG addition are shown in panels A B and C respectively The arrows indicate the expressed recombinant S1 74 kDa S2 47 kDa and N 49 kDa proteins Protein markers M cell lysate pellets lanes A1 B1 C1 and cell lysate supernatants lanes A2 B2 C2 of the S1 S2 and N proteins respectively are shown FIG 2 Expression and purification of SARS CoV S1 S2 and N recombinant proteins A Western blot analysis of the expressed SARS CoV S1 S2 and N recombinant proteins performed by using His 6 tagged monoclonal antibody Protein markers M and cell lysate pellets of the expressed S1 74 kDa S2 47 kDa and N 49 kDa proteins lanes A1 A2 A3 respectively are shown B Purity of purified proteins analyzed by SDS PAGE and Coomassie blue staining Protein markers M and purified S1 S2 and N proteins lanes B1 B2 B3 respectively are shown C Western blot analysis of purified recombinant proteins detected by polyclonal antibody to SARS CoV raised in rabbits Protein markers M and purified S1 S2 and N proteins lanes C1 C2 and C3 respectively are shown VOL 13 2006 USE OF S1 AND S2 TO RESOLVE SARS CoV FALSE POSITIVES 411 on July 10 2015 by UNIVERSITY OF ARIZONA LIBRARY http cvi asm org Downloaded from 86 6 and no cross reactivity H11002 with any of healthy serum samples specificity of 100 For the nucleocapsid protein N the results demonstrated that this protein evoked a strong immunoreactivity H11001H11001H11001 with 28 of 30 serum samples and moderate immunoreactivity H11001H11001 with 2 of 30 samples In addition we have found that the recombinant N protein also reacted either with all healthy serum samples obtained from China 10 of 10 samples tested or with all those obtained from healthy French donors 38 of 38 giving then false positive results Hence reacting with all negative serum samples indi cated the nonspecific nature of recombinant N protein which is not the case when using both recombinant S1 and S2 pro teins as diagnostic antigens Th